View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_212 (Length: 275)
Name: NF10855A_low_212
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_212 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 1329698 - 1329436
Alignment:
| Q |
1 |
tcttcttttggctcttnnnnnnnttcttcggctggttcctctggtggtggaagggccttgacttcattcatatcctcttccggttcaggttcgggttcgg |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329698 |
tcttcttttggctcttccaccacttcttcggctggttcctctggtggtggaagggccttgactgcattcatatcctcttccggttcaggttcgggttcgg |
1329599 |
T |
|
| Q |
101 |
gttccttggcttcttcatccgaattgttctcttcttgaacatcagctttattgctttgtgctagcatgttcttatctttgataaactcttccataacctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329598 |
gttccttggcttcttcatccgaattgttctcttcttgaacatcagctttattgctttgtgctagcatgttcttatctttgataaactcttccataacctc |
1329499 |
T |
|
| Q |
201 |
taacttctttggtgtgaccttatctatctcagggtactcagaagagcgacaaattccaatatt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329498 |
taacttctttggtgtgaccttatctatctcagggtactcagaagagcgacaaattccaatatt |
1329436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University