View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_216 (Length: 273)
Name: NF10855A_low_216
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_216 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 10 - 267
Target Start/End: Complemental strand, 34484891 - 34484634
Alignment:
| Q |
10 |
tatgaagcatgggagctctgtaataacttagatcatgtttggatcttgaaccctgtcaaccttacattgcatacaaatcttgcttcgaagtcttggacag |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34484891 |
tatgaagcatgggagctctgtaataacttagatcatgtttggatcttgaaccctgtcaaccttccattgcatacaaatcttgcttcgaagtcttggacag |
34484792 |
T |
 |
| Q |
110 |
atctaaattcactcatgcagattgcattcacatttcagatcttcagcgagatttacgcaattggaagcaaaatcacctttctgttggtgattatttcact |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34484791 |
atctaaattcactcatgcagattgcattcacatttcagatcttcagcgagatttacgcaattggaagcaaaatcacctttctgttggtgattatttcact |
34484692 |
T |
 |
| Q |
210 |
gaaatttatctctggtagtagtgttgttaatggccaagtgaccggtaaaacatataat |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34484691 |
gaaatttatctctggtagtagtgttgttaatggccaagtgaccggtaaaacatataat |
34484634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University