View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_221 (Length: 271)
Name: NF10855A_low_221
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_221 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 7 - 262
Target Start/End: Complemental strand, 2906417 - 2906162
Alignment:
| Q |
7 |
cattagacctattaatgttcgatttgatgaacatcatacaaacaattatggtaatactggtgcaatttggacaccaaaatctccacaaacagctgctact |
106 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2906417 |
cattagacctattaatgttcaatttgatgaacatcatacaaacaattatggtaatactggtgcaatttggacaccaaaatctccacaaacagctgctact |
2906318 |
T |
|
| Q |
107 |
gctgttagaagccctcgtggtacaaaatccccttctcattcccctattggtggtggcggtggagagcgtcgcgttcaattcggcacagttgtggaggtgg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2906317 |
gctgttagaagccctcgtggtacaaaatccccttctcattcccctgttggtggcggcggtggagagcgtcgtgttcaattcggcacagttgtggaggtgg |
2906218 |
T |
|
| Q |
207 |
gagatgaatttggtggcggcagcgaggaagaacaccaccataatgatgatattgtt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2906217 |
gagatgaatttggtggcggcagcgaggaagaacaccaccataatgatgattttgtt |
2906162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 7 - 262
Target Start/End: Complemental strand, 2854389 - 2854134
Alignment:
| Q |
7 |
cattagacctattaatgttcgatttgatgaacatcatacaaacaattatggtaatactggtgcaatttggacaccaaaatctccacaaacagctgctact |
106 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2854389 |
cattagacctattaatgttcaatttgatgaacatcatacaaacaattatggtaatactggtgcaatttggacaccaaaatctccacaaacagctgctact |
2854290 |
T |
|
| Q |
107 |
gctgttagaagccctcgtggtacaaaatccccttctcattcccctattggtggtggcggtggagagcgtcgcgttcaattcggcacagttgtggaggtgg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||| |||||||| ||||||||||||||| ||| |
|
|
| T |
2854289 |
gctgttagaagccctcgtggtacaaaatccccttctcattcccctgttggtggtggcggtgaggagtgtcgggttcaatttggcacagttgtggagatgg |
2854190 |
T |
|
| Q |
207 |
gagatgaatttggtggcggcagcgaggaagaacaccaccataatgatgatattgtt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2854189 |
gagatgaatttggtggcggcagcgaggaagaacaccaccataatgatgattttgtt |
2854134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University