View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_231 (Length: 268)
Name: NF10855A_low_231
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_231 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 7 - 268
Target Start/End: Complemental strand, 6466597 - 6466336
Alignment:
| Q |
7 |
aagagcaaaacaaatgcaaagattccagcttcgcaaacaataatcataagcattagttcataacaatctatattgtattgnnnnnnnnttaccaatcgtg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6466597 |
aagagcaaaacaaatgcaaagattccagcttcgcaaacaataatcataagcattagttcataacaatctatattgtattgaaaaaaaattaccaatcgtg |
6466498 |
T |
 |
| Q |
107 |
aaggtttgatttaacatcatacgtccatcttcattgtttcctgaaaataaaaatagtaagaataattgttacaaacataactctgaaatattttgaggtt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6466497 |
aaggtttgatttaacatcatacgtccatcttcattgtttcctgaaaataaaaatagtaagaataattgttacaaacataactctgaaatattttgaggtt |
6466398 |
T |
 |
| Q |
207 |
tggagaaaaagtattggaagattatgaaatgtttttaatataaaataagggtcgctaactga |
268 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6466397 |
tggagaaaaagtattgaaagattatgaaatgtttttaatataaaataagggtcgctaactga |
6466336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University