View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_232 (Length: 268)
Name: NF10855A_low_232
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_232 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 23 - 268
Target Start/End: Complemental strand, 44547176 - 44546936
Alignment:
| Q |
23 |
cccccgacattcacacaatcggtgcatcgctaactgttagatgggatcaagatctgaaccatttggtctcgatccaacggttaccgatgggctgactgga |
122 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44547176 |
cccccgacat-cacacaatcagtgcatcgctaactgttagatgggatcaagatctgaaccatttggtctcgatccaacggttaccgatgggctgactgga |
44547078 |
T |
 |
| Q |
123 |
agcaatggcattcgaatagatagtacatacacatcataaaagaaagataaaatgtgggctattagnnnnnnnnnnnnttgacaaatataagattgcatat |
222 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| ||||||||||||| |
|
|
| T |
44547077 |
agcaatgacattcga----atagtacatacacatcataaaagaaagataaaatgtggactattagaaaaaagaaaaattgacaaatttaagattgcatat |
44546982 |
T |
 |
| Q |
223 |
taccaagctttccacattaattatatcaatcacatcatcaccatca |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546981 |
taccaagctttccacattaattatatcaatcacatcatcaccatca |
44546936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University