View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_238 (Length: 265)
Name: NF10855A_low_238
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_238 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 4 - 259
Target Start/End: Complemental strand, 28505631 - 28505375
Alignment:
| Q |
4 |
gagaatttaaagagatgattttattgctgagtttataggttgaagaaggatgaatgcaaagttgaagatatacatatgatgttgaatggat-gaagaaga |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
28505631 |
gagaatttaaagagatgattttattgctgagtttataggttgaagaaggatgaatgcaaagttgaagatatacatatgatgttgaatgcaaagaagaaga |
28505532 |
T |
|
| Q |
103 |
tctcaatctgttttcaatttcaaatttagtagtccatatccgtttttatttattttatgattttgacattaaaagataaatatgctactaagtaagcaaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28505531 |
tctcaatctgttttcaatttcaaatttagtagtccatatccgtttttatttattttatgattttgacattaaaagataaatatgctactaagtaagcaaa |
28505432 |
T |
|
| Q |
203 |
aaactttttagacgagatgacacgaatctctttcaagttaactaagatattattcga |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
28505431 |
aaactttttagacgagatgacacgaatctctttcaagttaactaagattttgttcga |
28505375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University