View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_277 (Length: 252)
Name: NF10855A_low_277
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_277 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 108 - 247
Target Start/End: Original strand, 3645084 - 3645226
Alignment:
| Q |
108 |
ttataacatgattgttattgcattgggaattatcgtagacgtgttttcaatacaaagctacactttgtaccttctattattcattgtgattggtgaaaac |
207 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3645084 |
ttatatcatgattgttattgcattgggaattatcgtagacgtgttttcaatacaaagctacactttgtaccttctattattcattgtgattggtgaaaac |
3645183 |
T |
 |
| Q |
208 |
gatctcataac---atgataatcgcaagtttgaagaagtactt |
247 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3645184 |
gatctcataacatgatgataatcgcaagtttgaagaagtactt |
3645226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University