View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_290 (Length: 250)
Name: NF10855A_low_290
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_290 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 12 - 243
Target Start/End: Original strand, 36162890 - 36163122
Alignment:
| Q |
12 |
gctctatcatgtgtcaacttgaatttgacccagctgtatctccttaaggtgaaacctcttgctgtccnnnnnnn-atccgtcttactgcatttaagttga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
36162890 |
gctctatcatgtgtcaacttgaatttgacccagctgtatctccttaaggtgaagcctcttgctgtccttttttttatccgtcttactgcattaaagttga |
36162989 |
T |
 |
| Q |
111 |
ttaagactggccttgtatttttactaaactatctgtcttgagttcttgacaattggatgtgccttgtatttttacacgcttgttaattttgccctatttt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36162990 |
ttaagactggccttgtatttttactaaactatctgacttgagttcttgacaattggatgtgccttgtatttttacacgcttgttaattttgccctatttt |
36163089 |
T |
 |
| Q |
211 |
aaactatgctgtggtataactatgtaactccat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36163090 |
aaactatgctgtggtataactatgtaactccat |
36163122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University