View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_300 (Length: 250)
Name: NF10855A_low_300
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_300 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 17 - 244
Target Start/End: Original strand, 9730767 - 9730994
Alignment:
| Q |
17 |
gaggttgtgggtgtagtatgaccaaaggttgtattggtggccacagtggtgttgatgattgtgcacaaatgtccatatctttgttatttctgtggtgaag |
116 |
Q |
| |
|
||||||||||||||||||||| ||| |||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9730767 |
gaggttgtgggtgtagtatgatcaatggttatattggtggccgcagtggtgttgatgattgtgcacaaatgtccatatctttgttatttctgtggtgaag |
9730866 |
T |
|
| Q |
117 |
aaggctgttagaatagcaagttagcaactccgaatctaaattaaatagataaaattatgcacacaagaccacgagcgattgattgcggggtttggtcatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9730867 |
aaggctgttagaatagcaagttagcaactccgaatctaaattaaatagataaaattatgcacacaagaccacgagcgattgattgcggggtttggtcatt |
9730966 |
T |
|
| Q |
217 |
gtgcttacgtctccgctatattattcga |
244 |
Q |
| |
|
|||||||||||||||||||||| ||||| |
|
|
| T |
9730967 |
gtgcttacgtctccgctatatttttcga |
9730994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University