View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_31 (Length: 438)
Name: NF10855A_low_31
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 7 - 216
Target Start/End: Original strand, 32523003 - 32523212
Alignment:
| Q |
7 |
tttggtgttgacgatggtgacgtgggaggacatttggacgtggatgccgtcggtgtttgggctgtttccggctgccatgatattgacaccttgcgttttt |
106 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32523003 |
tttggagttgacgatggtgacatgggaggacatttggacgtggatgccgtcggtgtttgggctgtttccggctgccatgatattgacaccttgcattttt |
32523102 |
T |
|
| Q |
107 |
acattttcgcatccattgaacactatgtggaacatttgactattcattgatgtcaaaccactaatcataatgttttttgagttactaaattccaacgtct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32523103 |
acattttcgcatccattgaacactatgtggaacatttgactattcattgatgtcaaaccactaatcataatgttttttgagttactaaattccaacgtct |
32523202 |
T |
|
| Q |
207 |
ggaaaccacc |
216 |
Q |
| |
|
| |||||||| |
|
|
| T |
32523203 |
gaaaaccacc |
32523212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 344 - 433
Target Start/End: Original strand, 32523477 - 32523566
Alignment:
| Q |
344 |
attgttttgtgtaatatgtgcaatatgatttataaacaaaccagaaagaatcatatgatataaccaattattgacatattatttttatgt |
433 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32523477 |
attggtttgtgtgatatgtgcaatatgatttataaacaaaccagaaagaatcatatgatataaccaattattgacatattatttttatgt |
32523566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 248 - 341
Target Start/End: Original strand, 32523249 - 32523341
Alignment:
| Q |
248 |
accgtcaacgccttttttctta-tataaaataatatcatcaaataattactannnnnnnnnnacaaaacaaaatgcaactttgttgtgttagtaa |
341 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32523249 |
accgtcaacgccttttttctttctataaaataatatcatcaaataattacta--ttttttttacaaaacaaaatgcaactttgttgtgttagtaa |
32523341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University