View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_319 (Length: 248)
Name: NF10855A_low_319
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_319 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 163 - 243
Target Start/End: Original strand, 6703330 - 6703410
Alignment:
| Q |
163 |
gttattcatcattatagtcgattttctaggacattttatcaagaatattatgatagagtacctagtgttatattgttggag |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6703330 |
gttattcatcattatagtcgattttctaggacattttatcaagaatattatgatagagtacctagtgttatatggttggag |
6703410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 12 - 73
Target Start/End: Original strand, 6703178 - 6703239
Alignment:
| Q |
12 |
atggacatccgaatttgtgtttatgccattgatcatattaatttggtatgatattcttccaa |
73 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6703178 |
atggacatcagaatttgtgtttatgccattgatcatattaatttggtatgatattcttccaa |
6703239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 225
Target Start/End: Original strand, 8731061 - 8731101
Alignment:
| Q |
185 |
tttctaggacattttatcaagaatattatgatagagtacct |
225 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
8731061 |
tttctaggaaattttatcaagaatatcttgatagagtacct |
8731101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University