View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_328 (Length: 247)
Name: NF10855A_low_328
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_328 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 59 - 247
Target Start/End: Complemental strand, 45592875 - 45592687
Alignment:
| Q |
59 |
atataaataaaataagttcttacctcaagttttctcaattcagcttctttagcagctttcttactgttctcccatgctgttatggttgaaagtcttccct |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45592875 |
atataaataaaataagttcttacctcaagttttctcaattcagcttctttagcagctttcttactgttctcccatgctgttatggttgaaagtcttctct |
45592776 |
T |
|
| Q |
159 |
gagctctgctcatcaaattcatgactcgatgtaataaggttctaaaaatttgaaaattaaacattagatggtgaaagctcttacttgtt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45592775 |
gagctctgctcatcaaattcatgactcgatgtaataaggttctaaaaatttgaaaattaaacattagatggtgaaagctcttacttgtt |
45592687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University