View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_336 (Length: 245)
Name: NF10855A_low_336
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_336 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 48484626 - 48484382
Alignment:
| Q |
1 |
agtatcaaagatatagtcctgtagtgttgtgtgtaccgtgtcttcatatctccataatacttctgcgcttctttctcatttttgaaataacaaaacaaat |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48484626 |
agtatcaaagatatagtcctgcagtgttgtgtgtaccgtgtcttcatatctccataatatttctgcgcttctttctcatttttgaaataacaaaacaaat |
48484527 |
T |
|
| Q |
101 |
ttcttcagatcacggaacacaatccccaagctggaattcccatgaagttaaatcagaaacaggtgttttcctttttgcaaggtaagcatgcatttcatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48484526 |
ttcttcagatcacggaacacaatccccaagctggaattcccatgaagttaaatcagaaacaggtgttttcctttttgcaaggtaagcatgcatttcatat |
48484427 |
T |
|
| Q |
201 |
gaacttttacatactgaaacttccatttcttgtacatgctcaggt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48484426 |
gaacttttacatactgaaacttccatttcttgtacatgatcaggt |
48484382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University