View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_346 (Length: 244)
Name: NF10855A_low_346
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_346 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 22 - 180
Target Start/End: Complemental strand, 19011379 - 19011220
Alignment:
| Q |
22 |
tatatatgatggaaagatggcagaaaaacagagaaaaa-tatcaaggtatgaagatggtgttctgcctaatattaagaaaaggcttgagaaagaatcatc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||||||||||||||||||||| |||||| || |||||||| |
|
|
| T |
19011379 |
tatatatgatggaaagatggcagaaaaatagagaaaaaatctcaaggtatgaagatggtgttctgcctaatattaagaaaaagcttgacaaggaatcatc |
19011280 |
T |
|
| Q |
121 |
ttataccaagaactggcttgtaaggtaaaatttccattataccaaatgttgtctttgtta |
180 |
Q |
| |
|
|||||||| |||||||||||||||||| |||| ||||| | ||||| |||||||||||| |
|
|
| T |
19011279 |
ttataccagaaactggcttgtaaggtaatattttcattacatcaaattttgtctttgtta |
19011220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University