View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_362 (Length: 243)
Name: NF10855A_low_362
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_362 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 43703338 - 43703564
Alignment:
| Q |
1 |
ggattagtctttcaattgcatgcagagaatactttggttt----aaaaaggaaacaattttataaacttatgttcatctaaaaccacctttatcgaacac |
96 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43703338 |
ggattagtctttcaattgcatgcctggaatactttgggtttaccaaaaaaaaaacaattttataaacttatgtttatctaaaaccacctttatcgaacac |
43703437 |
T |
|
| Q |
97 |
ttgcccaaatgcacactctttttcgtattgataatgaattacttttgttggttcaaccacctacattgaggaatcaaaatactagttgagtttgtcttgt |
196 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43703438 |
ttgcccaaatgcacactttttttcgtattgataatgaattacttttgtt-gttcaaccatctacattgaggaatcaaaatactagttgagtttgtcttgt |
43703536 |
T |
|
| Q |
197 |
gagattcttatcttgtggttggtccatc |
224 |
Q |
| |
|
||||||||||||||||| |||||||||| |
|
|
| T |
43703537 |
gagattcttatcttgtgattggtccatc |
43703564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University