View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_371 (Length: 242)
Name: NF10855A_low_371
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_371 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 44826515 - 44826738
Alignment:
| Q |
19 |
acatcagggtcacaatctcttgaagctgcaaaacatggacagtgtcgacttctacactgactcttagtacactgacatcctccaaatagatttttacaga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44826515 |
acatcagggtcacaatctcttgaagctgcaaaacatggacagtgtcgacttctacactgactcttagtacactgacatcctccaaatcgatttttacaga |
44826614 |
T |
 |
| Q |
119 |
gctttgaacacctgaaggtagaaaatataactgatcacattgaaaacatagttgttttccatcgaaaagtaacataattaaatgaaaattgacataccca |
218 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44826615 |
gctttgaacacctgaaggtaaaaaatataactgatcacattgaaaacatagttgttttccatcgaaaagtaacataattaaatgaaaattgacataccca |
44826714 |
T |
 |
| Q |
219 |
caatatttgtcacagcaataacca |
242 |
Q |
| |
|
|||||||| ||||||||| ||||| |
|
|
| T |
44826715 |
caatatttttcacagcaaaaacca |
44826738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University