View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_372 (Length: 242)
Name: NF10855A_low_372
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_372 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 240
Target Start/End: Complemental strand, 25745194 - 25744974
Alignment:
| Q |
20 |
ttcattggcaagagcatctaagttagctgcttcagattgttttcatataaacttcaactttgttaaaacatataaacatgaatgaaaccacttaaacttt |
119 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25745194 |
ttcattggcaagagcatctaatttagctgcttcagattgttttcatataaacttcaactttgttaaaacatataaacatgaatcaaaccacttaaacttt |
25745095 |
T |
|
| Q |
120 |
atcaaggtgattatttcattcaagttacactaatgctcttatgtcttgcagagtccagatgggttaacagtggtttcagccggaggagatgagactcttc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25745094 |
atcaaggtgattatttcattcaagttacactaatgctcttatgtcttgcagagtccagatgggttaacagtggtttcagccggaggagatgagactcttc |
25744995 |
T |
|
| Q |
220 |
gcttttgggatatttttggac |
240 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
25744994 |
gcttttgggatatttttggac |
25744974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 69 - 240
Target Start/End: Original strand, 4348908 - 4349081
Alignment:
| Q |
69 |
aacttcaactttgttaaaacatataaacatgaatgaaaccacttaaactttatcaaggtgattatttcattcaagtta--cactaatgctcttatgtctt |
166 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
4348908 |
aacttcaactatgttaaaacatataaacatgaatgaaaccacttaaactttaacaaggggattatttctttcaagttatacactaatgctcttatgtctt |
4349007 |
T |
|
| Q |
167 |
gcagagtccagatgggttaacagtggtttcagccggaggagatgagactcttcgcttttgggatatttttggac |
240 |
Q |
| |
|
||||||| ||||||| ||||| ||||||||| | || ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4349008 |
gcagagttcagatggtttaactgtggtttcatctgggggagatgagacgcttcgcttttgggatatttttggac |
4349081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University