View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10855A_low_385 (Length: 241)

Name: NF10855A_low_385
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10855A_low_385
NF10855A_low_385
[»] chr2 (1 HSPs)
chr2 (32-221)||(14801654-14801843)


Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 32 - 221
Target Start/End: Complemental strand, 14801843 - 14801654
Alignment:
32 ttaagtaccaggcaaaataccgttatgatcaacaacaaaaattgaatcaaacccaaagcagaacttgaataaaaattcaatccttatgagattaaatgag 131  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
14801843 ttaagtaccaggcaaaataccgttatgatcaacaacaaaaattgaatcaaaaccaaagcagaacttgaataaaaattcaatccttatgagattaaatgag 14801744  T
132 tcttatgtggctgtgtgatcacaattattgcaaatggagcttcttaaattgtttattattgtaaatggaagcgttttcctaatatgaaca 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14801743 tcttatgtggctgtgtgatcacaattattgcaaatggagcttcttaaattgtttattattgtaaatggaagcgttttcctaatatgaaca 14801654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University