View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_395 (Length: 239)
Name: NF10855A_low_395
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_395 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 2 - 219
Target Start/End: Original strand, 47120874 - 47121092
Alignment:
| Q |
2 |
tgttttgcatacaccttttttgggtatgtcattcttacatgtgcatcctcagcttcgacatgcagatgagagatgcgaggaagctgaaatgagagttagg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47120874 |
tgttttgcatacaccttttttgggtatgtcattcttacatgtgcatcctcagcttcgacatgcagatgagagatgcgaggaagctgaaatgagagttagg |
47120973 |
T |
|
| Q |
102 |
caactagagcaacaggtaatacattttttgaaacatttaatatgtgcatgttgctttgacaacctttctttcattatttgtcttgtgcacaagt-aacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47120974 |
caactagagcaacaggtaatacattttttgaaacatttaatatgtgcatgttgctttgacaacctttctttcattatttgtcttgtgcacaagtaaacca |
47121073 |
T |
|
| Q |
201 |
tattataaacagatcaatg |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
47121074 |
tattataaacagatcaatg |
47121092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University