View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_397 (Length: 239)
Name: NF10855A_low_397
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_397 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 28519034 - 28518944
Alignment:
| Q |
1 |
gacttcaatttctgacagttttgcagcaaatgcattgaagctctttgtgtagctgtatacaatggactctttggcttcatgataactaagt |
91 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28519034 |
gacttcatcttctgacagttttgcagcaaatgcattgaagctctttgtgtagctatatacaatggactctttggcttcatgataactaagt |
28518944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 171 - 221
Target Start/End: Complemental strand, 28518866 - 28518816
Alignment:
| Q |
171 |
taaagaaatgcttgattgaattaataaggttaccttcccttcacagaagat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28518866 |
taaagaaatgcttgattgaattaataaggttaccttcccttcacagaagat |
28518816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 17 - 79
Target Start/End: Original strand, 12728891 - 12728953
Alignment:
| Q |
17 |
agttttgcagcaaatgcattgaagctctttgtgtagctgtatacaatggactctttggcttca |
79 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12728891 |
agtttagcagcaaatgcattaaagctctttgtgtagctgtatactatggactctttggcttca |
12728953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 14 - 79
Target Start/End: Complemental strand, 34291209 - 34291144
Alignment:
| Q |
14 |
gacagttttgcagcaaatgcattgaagctctttgtgtagctgtatacaatggactctttggcttca |
79 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
34291209 |
gacagtttagcagcaaatgcattaaagctctttgtgtagctgtatactatggattctttggcttca |
34291144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University