View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_399 (Length: 238)
Name: NF10855A_low_399
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_399 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 4 - 238
Target Start/End: Original strand, 41255782 - 41256016
Alignment:
| Q |
4 |
atcacaacgacccatcaatctcttcttcaaaattatccaccccaaaacccaaaattcaaaacttttcatcaatcaataatgacccatcttcgaattctaa |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41255782 |
atcacaacgacccatcaatctcttcttcaaaattatccaccacaaaacccaaaaatcaaaacttttcatcaatcaataatgacccatcttcgaattctaa |
41255881 |
T |
 |
| Q |
104 |
ccctacaattcaaaacggtgcagtttcagggtctataactcatttggaagggttgagagcattgtgcaggaagaatgatggaaaagggttaagggatttc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41255882 |
ccctacaattcaaaacggtgcagtttcagggtctataactcatttggaagggttgagtgcattgtgcaagaagaatgatggaaaagggttaagggatttc |
41255981 |
T |
 |
| Q |
204 |
attcgtgtgaattttaaggataaggtaacaatcaa |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41255982 |
attcgtgtgaattttaaggataaggtaacaatcaa |
41256016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University