View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10855A_low_401 (Length: 237)

Name: NF10855A_low_401
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10855A_low_401
NF10855A_low_401
[»] chr2 (1 HSPs)
chr2 (1-232)||(35449821-35450052)
[»] chr4 (1 HSPs)
chr4 (1-68)||(21010633-21010700)


Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 35449821 - 35450052
Alignment:
1 gagaaagagatgaagcacaagaaaaatgtgaaagacttctcttggaaaagctagttttccatcaacaacaaaatgctccactttccggagtttcaagcat 100  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
35449821 gagaaagagatgaagcacaagaaaaatgtcaaagacttctcttggaaaagctagttttccatcaacaacaaaatgatccactttccggagtttcaagcat 35449920  T
101 tgaagatgaacaagttacaagaaaaggaattgactcaaacaatggtttttctttgtcttcatcagattgtgaagaaagcattgtttcttcaccaattatt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
35449921 tgaagatgaacaagttacaagaaaaggaattgactcaaacaatggtttttctttgtcttcttcagattgtgaagaaagcattgtttcttcaccaattatt 35450020  T
201 gatcaatcaatgattgaagtactaacaccaaa 232  Q
    ||||||||||||||||||||||||||||||||    
35450021 gatcaatcaatgattgaagtactaacaccaaa 35450052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 21010700 - 21010633
Alignment:
1 gagaaagagatgaagcacaagaaaaatgtgaaagacttctcttggaaaagctagttttccatcaacaa 68  Q
    ||||||||||||||||||||||||||||  |||||||| |||| |||||| || ||||||| ||||||    
21010700 gagaaagagatgaagcacaagaaaaatgccaaagacttttcttagaaaagttacttttccaacaacaa 21010633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University