View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_405 (Length: 237)
Name: NF10855A_low_405
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_405 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 26 - 181
Target Start/End: Complemental strand, 28722626 - 28722471
Alignment:
| Q |
26 |
cacagagaaggggaggataaatgaaggggacaatcacagaggatgggggcggtgccgcggttgcagtcttgcaggaggtgaactacgttttggcttttcc |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28722626 |
cacagagaaggggaggataaatgaaggggacaatcacagaggatgggggcggtgccacggttgcagtcttgcaggaggtgaactacgttttggcttttcc |
28722527 |
T |
|
| Q |
126 |
aggataggttttgaatggaataaagattggctacagtaaaatacgttttggctttc |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28722526 |
aggataggttttgaatggaataaagattggctacagtaaaatacgttttggctttc |
28722471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University