View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_406 (Length: 237)
Name: NF10855A_low_406
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_406 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 9 - 231
Target Start/End: Original strand, 31102084 - 31102306
Alignment:
| Q |
9 |
tggtgttgtcacttatcatgaaaatgttcacccaaaagtgttttatattctttgtttgtctcctaataatttcccctaagttaacgctcattcctaacag |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
31102084 |
tggtgttgtcacttatcatgaaaatgttcacccaaaagtgttttatattctttgtttgtctcctaataatttctcctaagttaacgctcattccaaacag |
31102183 |
T |
 |
| Q |
109 |
cgtggaaggcagaaaagtttttaccatcaacaggaaggaaaaccatctcaaaggtgaatttctctaatctcaccctttgtgtattactcgaatttaggat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
31102184 |
cgtggaaggcagaaaagtttttaccatcaacaggaaggaaaacgatttcaaaggtgaatttctctaatctcactctttgtgttttactcgaatttaggat |
31102283 |
T |
 |
| Q |
209 |
ttgcctaacatgaatctcacaag |
231 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
31102284 |
ttgcctaacatgaatctcacaag |
31102306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University