View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_407 (Length: 236)
Name: NF10855A_low_407
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_407 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 29 - 215
Target Start/End: Original strand, 3675349 - 3675535
Alignment:
| Q |
29 |
atcaatcacagctgcagttgtaggtcgaaatatattattcccagtgataagttcatgaatttgacgatacacttggcttcctgtgtatatacttgtaaaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3675349 |
atcaatcacagctgcagttgtaggtcgaaatatattattcccagtgataagttcatgaatttgacgatacacttggcttcctgtgtatatacttgtaaaa |
3675448 |
T |
 |
| Q |
129 |
aatgctaccacaagcaaatacctaagattnnnnnnnttattaattaaagttccatacaaattaaattttgacaaaaacccatcatat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3675449 |
aatgctaccacaagcaaatacctaagattaaaaaaattattaattaaagttccatacaaattaaattttgacaaaaacccatcatat |
3675535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University