View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_408 (Length: 236)
Name: NF10855A_low_408
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_408 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 16 - 219
Target Start/End: Complemental strand, 47628255 - 47628052
Alignment:
| Q |
16 |
ggacatccactggaggaggagagggaatagttggtggaatgacctgaatatgattcatgtccagctgaatggcctgaatttcttctcgtcctgccgtgca |
115 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47628255 |
ggacatacactggaggaggagagggaatagttggtggaatgacctgaatatgattcatgtccagctgaatggcctgaatttcttctcgtcctgccgtgca |
47628156 |
T |
|
| Q |
116 |
tgaaaaatgctggttccatgggaaatggcatttcaattgagacactattaagatatgaaacaacagttcccattgtaggcctatcatctggatattgttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
47628155 |
tgaaaaatgctggttccatgggaaatggcatttcaattgagacattattaagatatgaaacaacagttcccattgtaggcctatcatctggattttcttg |
47628056 |
T |
|
| Q |
216 |
gaca |
219 |
Q |
| |
|
|||| |
|
|
| T |
47628055 |
gaca |
47628052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University