View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_411 (Length: 236)
Name: NF10855A_low_411
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_411 |
 |  |
|
| [»] scaffold0100 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0100 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 11 - 122
Target Start/End: Complemental strand, 49334 - 49225
Alignment:
| Q |
11 |
tgagataggagctagtaaacatctaattgaagtcaaagatgatttttcagtaaccaaaaatggaagtcaacgatgatttattaagaatttcatactagtc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49334 |
tgagataggagctagtaaacatctaattgaagtcaaagatgattt--cagtaataaaaaatggaagtcaatgatgatttattaagaatttcatactagtc |
49237 |
T |
 |
| Q |
111 |
cttacttcctct |
122 |
Q |
| |
|
|||||||||||| |
|
|
| T |
49236 |
cttacttcctct |
49225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University