View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_424 (Length: 230)
Name: NF10855A_low_424
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_424 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 3272192 - 3272419
Alignment:
| Q |
1 |
tagtaaaaataattattggtcagactttatttaccttctaaccgaaccggattgctagggcctctttccctaaaaaccggagggttaacacaaannnnnn |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3272192 |
tagtagaaataattattggtcagactttatttaccttctaaccgaaccggattgctagggcctcttcccctaaaaaccggagggttaacacaattttttt |
3272291 |
T |
|
| Q |
101 |
nnnnn----gacaaacagtgtggtttcatgttttttacatcatataacagcaatttcacaagcaatgtggttagatagattgttcaaaagaaagcatttt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3272292 |
tttttttttgacaaacagtgtggtttcatgttttttacatcatataacagcaatttcacaagcaatgtggttagatagattgttcaaaagaaaccatttt |
3272391 |
T |
|
| Q |
197 |
ctttgaagggagttttacattctgtttt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
3272392 |
ctttgaagggagttttacattctgtttt |
3272419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University