View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_435 (Length: 230)
Name: NF10855A_low_435
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_435 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 5738099 - 5738285
Alignment:
| Q |
1 |
gtcatttgccgcagttaagctcaccggatattgttattccggtcatgcttagacacattcaacttaatattgagcccacgaggtaaatacttgttattta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5738099 |
gtcatttgccgcagttaagctcaccggatattgttattccggtcttgcttagacacattcaacttaatattgagcccacgaggtaaatacttgttattta |
5738198 |
T |
 |
| Q |
101 |
catcactccataattgtgatttagatttcactcggtcaatagttagggacgttagttggactaagatcggataattcaattttcaaa |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5738199 |
catcactccataattgtgatttagatttcactcaatcaatagttagggacgttagttggactaagatcggataattcaattttcaaa |
5738285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University