View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_447 (Length: 230)
Name: NF10855A_low_447
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_447 |
 | |
|
| [»] scaffold0100 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0100 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 49146 - 49025
Alignment:
| Q |
1 |
atttccctttttgtttttaaagaaccaaatcgttttgtgacaggtaactggatgaagttagcaaaaggaggtaagctagctgctagatgattatagagca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49146 |
atttccctttttgtttttaaagaaccaaatctttttgtgacaggtaactggatgaagttagcaaaaggaggtaagcta---gctagatgattatagagca |
49050 |
T |
|
| Q |
101 |
ttacacgaacaaagattctgccata |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
49049 |
ttacacgaacaaagattctgccata |
49025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0100; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 178 - 230
Target Start/End: Complemental strand, 48969 - 48917
Alignment:
| Q |
178 |
agggaaattttgtcacgtccatttattatgtaatcatttatagatttttatga |
230 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48969 |
agggaagttttgtcacgtccatttattatataatcatttatagatttttatga |
48917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University