View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_454 (Length: 230)
Name: NF10855A_low_454
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_454 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 6916260 - 6916479
Alignment:
| Q |
1 |
acttgcctttaagttggcttctatctatgcttttagagagtgttacacagcttccagaccagttatattagaacctgttatgcttgttgaactgaaagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6916260 |
acttgcctttaagttggcttctatctatgcttttagagagtgttacacagcttccagaccagttatattagaacctgttatgct----gaactgaaagta |
6916355 |
T |
|
| Q |
101 |
ccaacagaatttcagggagctgttgctggtgacctcaacaagagaaaaggtgtgattgttggcaatgatcaggatgaagatgattccgtcataacagctc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |||| ||||| ||||||| |
|
|
| T |
6916356 |
ccaacagaatttcagggagctgttgctggtgacctcaacaagagaaaaggtgtgattgttggcaatgttcaggacgaagattattctgtcattacagctc |
6916455 |
T |
|
| Q |
201 |
atgtccctcttaacaatatgtttg |
224 |
Q |
| |
|
|||| ||||||||||||||||||| |
|
|
| T |
6916456 |
atgtgcctcttaacaatatgtttg |
6916479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 72; Significance: 7e-33; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 39 - 142
Target Start/End: Complemental strand, 15037928 - 15037825
Alignment:
| Q |
39 |
agtgttacacagcttccagaccagttatattagaacctgttatgcttgttgaactgaaagtaccaacagaatttcagggagctgttgctggtgacctcaa |
138 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| ||||||||||||||||| || |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15037928 |
agtgttacactgcttccagaccaactatattagagcctgttatgcttgttgagctaaaagtaccaaatgaatttcagggagctgttgctggtgacctcaa |
15037829 |
T |
|
| Q |
139 |
caag |
142 |
Q |
| |
|
|||| |
|
|
| T |
15037828 |
caag |
15037825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 142 - 204
Target Start/End: Complemental strand, 15037738 - 15037676
Alignment:
| Q |
142 |
gagaaaaggtgtgattgttggcaatgatcaggatgaagatgattccgtcataacagctcatgt |
204 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||| |||||| || ||||| | ||||||||| |
|
|
| T |
15037738 |
gagaaagggtatgattgttggcaatgatcaggatggagatgactctgtcattatagctcatgt |
15037676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 37
Target Start/End: Complemental strand, 15038090 - 15038055
Alignment:
| Q |
2 |
cttgcctttaagttggcttctatctatgcttttaga |
37 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15038090 |
cttgcctttaagatggcttctatctatgcttttaga |
15038055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University