View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_473 (Length: 229)
Name: NF10855A_low_473
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_473 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 20 - 215
Target Start/End: Complemental strand, 47524644 - 47524449
Alignment:
| Q |
20 |
attgtgagactaaggccaaattgttcctgtaatgatataaaaataacttctaccaaaattgtttgactaaggccaagagttaacaaatgttgcacgacaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47524644 |
attgtgagactaaggccaaattgttcctgtaatgatataaaaataacttctaccaaaattgtgtgactaaggccaagagttaacaaatgttgcacgacaa |
47524545 |
T |
|
| Q |
120 |
aacaccttggtgtttcactttcacttttaaccaaagttgtgttcctctcccttttgcttgacgatggtactctattctctaacaccaaatgatgtc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47524544 |
aacaccttggtgtttcactttcacttttaaccatagttgtgttcctctcccttttgcttgacgatggtactctattctctaacaccaaatgatgtc |
47524449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University