View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_475 (Length: 229)
Name: NF10855A_low_475
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_475 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 23334592 - 23334364
Alignment:
| Q |
1 |
gcgcaggctgtcgcgaagttgcccaggttttttggaaaggagcatggcactgaaattgatgagttcattatgctttgtgatccaatgaacaatgagatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23334592 |
gcgcaggctgtcgcgaagttgcccaggtgttttggaaaggagcatggcactgaaattgatgagttcattatgctttgtgatccaaagaacaatgagatag |
23334493 |
T |
|
| Q |
101 |
aggtgcaggttgcgattaaagaaaacaaggtgtatttcaagaacggttggtttgggatgaaggatttctatgctattgatattggtgcatgggctttgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23334492 |
aggtgcaggttgcgattaaagaaaacaaggtgtatttcaagaacggttggtttgggatgaaggatttctatgctattgatattggtgcatgggctttgct |
23334393 |
T |
|
| Q |
201 |
tacatatgaagattcgagtttcatgcgga |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23334392 |
tacatatgaagattcgagtttcatgcgga |
23334364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 39 - 210
Target Start/End: Complemental strand, 2029908 - 2029735
Alignment:
| Q |
39 |
ggagcatggcactgaaattgatgagttcattatgctttgtgatccaatgaacaatgagat--agaggtgcaggttgcgattaaagaaaacaaggtgtatt |
136 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||| ||||||||||| |||||| || |||| ||| ||||| |||||||| | || |
|
|
| T |
2029908 |
ggagcatggcatggaaattgatgagttcattatgctgtgtgatccaagaaacaatgagatagagaggtccatgttgagatcaaagacaacaaggtatttt |
2029809 |
T |
|
| Q |
137 |
tcaagaacggttggtttgggatgaaggatttctatgctattgatattggtgcatgggctttgcttacatatgaa |
210 |
Q |
| |
|
||||||| || ||||||||| ||||||||||||| |||||||||| |||||||||| |||||||||||| |
|
|
| T |
2029808 |
tcaagaatggctggtttgggttgaaggatttctacaatattgatatttttgcatgggctactcttacatatgaa |
2029735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University