View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_481 (Length: 228)
Name: NF10855A_low_481
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_481 |
 |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |  |
|
| [»] scaffold0707 (1 HSPs) |
 |  |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (3 HSPs) |
 |  |  |
|
| [»] scaffold0100 (1 HSPs) |
 |  |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
| [»] scaffold1185 (1 HSPs) |
 |  |  |
|
| [»] scaffold0460 (2 HSPs) |
 |  |  |
|
| [»] scaffold0275 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
| [»] scaffold0288 (1 HSPs) |
 |  |  |
|
| [»] scaffold0690 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0157 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (2 HSPs) |
 |  |  |
|
| [»] scaffold1372 (1 HSPs) |
 |  |  |
|
| [»] scaffold0864 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0330 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold1787 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold1709 (1 HSPs) |
 |  |  |
|
| [»] scaffold1331 (1 HSPs) |
 |  |  |
|
| [»] scaffold0394 (1 HSPs) |
 |  |  |
|
| [»] scaffold0254 (1 HSPs) |
 |  |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
| [»] scaffold0063 (1 HSPs) |
 |  |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0555 (1 HSPs) |
 |  |  |
|
| [»] scaffold0517 (1 HSPs) |
 |  |  |
|
| [»] scaffold0276 (1 HSPs) |
 |  |  |
|
| [»] scaffold0199 (1 HSPs) |
 |  |  |
|
| [»] scaffold0065 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 148)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 5308220 - 5308319
Alignment:
| Q |
1 |
atttttcagggtatggaaaaatataatgatactatatcttcattaccgtaaatgcatacaaaagcttgtttacatttttaggtgctcgcggttgttgaaa |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5308220 |
atttttcagggtttggaaaaatataatgatattatatcttcatcaccgtaaatgcatacaaaagcttgtttacatttttaggtgctcgcggttgttgaaa |
5308319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 95 - 174
Target Start/End: Original strand, 5308687 - 5308766
Alignment:
| Q |
95 |
ttgaaaatttaaactgaatgtacatcttgtttgtttttctcaaaaatcaataaaactaattttaaaattttgacagtgtc |
174 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5308687 |
ttgaaattttaaactgaatgtacatcttgtttgtttttctcaaaaatcaataaaactaattttaaaattttgacagtgtc |
5308766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 10244962 - 10244915
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10244962 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
10244915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 23102632 - 23102585
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23102632 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
23102585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 25833551 - 25833598
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25833551 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
25833598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 37300172 - 37300125
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37300172 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
37300125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 47641042 - 47641089
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47641042 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
47641089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 47999777 - 47999824
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47999777 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
47999824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 2228972 - 2229018
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2228972 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
2229018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 2681093 - 2681139
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2681093 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
2681139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 9877340 - 9877294
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9877340 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
9877294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 12640662 - 12640616
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12640662 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
12640616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 15238886 - 15238932
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15238886 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
15238932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 19753041 - 19752995
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19753041 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
19752995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 29617402 - 29617448
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29617402 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
29617448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 35950125 - 35950171
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35950125 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
35950171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 42443686 - 42443732
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42443686 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
42443732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 44616599 - 44616645
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44616599 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
44616645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 3766807 - 3766854
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3766807 |
gatccccgtgagcttaactcagttggtagggatattgcatattatatg |
3766854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 21066883 - 21066930
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21066883 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgt |
21066930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 24781030 - 24781073
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24781030 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
24781073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 27510327 - 27510284
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27510327 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
27510284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 36391974 - 36391931
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36391974 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
36391931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 5990218 - 5990172
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5990218 |
atccccgtgagcttagctcagttggtagggatattgtatattatatg |
5990172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 12772112 - 12772158
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12772112 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatg |
12772158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 24061402 - 24061356
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24061402 |
atccccgtgagcttagctcagttggtaggaatattgcatattatatg |
24061356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 27424836 - 27424882
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27424836 |
atccccgtgagcttagctcagttggaagggatattgcatattatatg |
27424882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 30806112 - 30806158
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30806112 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
30806158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 30940768 - 30940814
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30940768 |
atccccgtgagcttagctcagttggtagtgatattgcatattatatg |
30940814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 31026216 - 31026262
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31026216 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
31026262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 36174391 - 36174433
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36174391 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
36174433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 38889566 - 38889520
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38889566 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
38889520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 41084040 - 41084082
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41084040 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
41084082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 46534821 - 46534775
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46534821 |
atccccatgagcttagctcagttggtagggatattgcatattatatg |
46534775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 30388575 - 30388534
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30388575 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
30388534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 18223787 - 18223743
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18223787 |
cccgtgagcttaactcagttggtagggatattgcatattatatgt |
18223743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 24062081 - 24062037
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24062081 |
cccgtgagcttagctcagttagtagggatattgcatattatatgt |
24062037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 36720109 - 36720149
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36720109 |
cgtgagcttagctcagttggtagggatattgcatattatat |
36720149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 9712272 - 9712225
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9712272 |
gatctccgtgagcttaactcagttggtagggatattgcatattatatg |
9712225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 32677008 - 32676969
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32677008 |
tgagcttagctcagttggtagggatattgcatattatatg |
32676969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 182 - 221
Target Start/End: Complemental strand, 32984284 - 32984245
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32984284 |
gtgagcttagctcagttggtagggatattgcatattatat |
32984245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 34267621 - 34267578
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34267621 |
cccgtgagcttagctcagttggtaggaatattgcatattatatg |
34267578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 41465834 - 41465877
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41465834 |
cccgtaagcttagctcagttggtagggatattgcatattatatg |
41465877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 9929977 - 9929931
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9929977 |
atccccgttagcttagctcagttggtagggatattgaatattatatg |
9929931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 15106764 - 15106718
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15106764 |
atcccggtgagcttaactcagttggtagggatattgcatattatatg |
15106718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 21388520 - 21388566
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21388520 |
atccccatgagcgtagctcagttggtagggatattgcatattatatg |
21388566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 24692472 - 24692518
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
24692472 |
atccccgtgaggttagctcagttggtagggatattgcatattctatg |
24692518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 29625918 - 29625964
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29625918 |
atccacgtgagcttaactcagttggtagggatattgcatattatatg |
29625964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 33996954 - 33996908
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33996954 |
atccccgtgagtatagctcagttggtagggatattgcatattatatg |
33996908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 35815835 - 35815881
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
35815835 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatg |
35815881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 36389739 - 36389693
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
36389739 |
atccccgtgagcttagctcagttggtagggatattgtattttatatg |
36389693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 218
Target Start/End: Complemental strand, 36469778 - 36469736
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatatta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36469778 |
atccccgtgagcttagctcagttggtagggatattacatatta |
36469736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 36622171 - 36622217
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36622171 |
atccccgtgaacttagctcaattggtagggatattgcatattatatg |
36622217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 39098133 - 39098179
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39098133 |
atccctgtgagcttagttcagttggtagggatattgcatattatatg |
39098179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 48119467 - 48119513
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48119467 |
atccctgtgagcttagctcagttggtagggatattgcattttatatg |
48119513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 48288470 - 48288428
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48288470 |
ccgtgagcttaactcagttggtagggatattgcatattatatg |
48288428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 177 - 222
Target Start/End: Original strand, 5833037 - 5833082
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
5833037 |
tccccgtgagcttagctcagttggtagggataatgcataatatatg |
5833082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 182 - 223
Target Start/End: Complemental strand, 24732618 - 24732577
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24732618 |
gtgagcttagctcagttgttagggatattgcatattatatgt |
24732577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 177 - 222
Target Start/End: Complemental strand, 26816730 - 26816685
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
26816730 |
tccccgtgagcttagctcagttggtagggataatgcataatatatg |
26816685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 4960788 - 4960827
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4960788 |
tgagcttagctcagttagtagggatattgcatattatatg |
4960827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 9497963 - 9498010
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||| ||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9497963 |
atccccgcgagtttagctcaattggtagggatattgcatattatatgt |
9498010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 19922169 - 19922122
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||| |||||||| |
|
|
| T |
19922169 |
atccccgtgagcttagcttagttgatagggatattgcattttatatgt |
19922122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 28805304 - 28805343
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28805304 |
tgagcttagctcagttggtagggatattgcatatcatatg |
28805343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 32619347 - 32619394
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
32619347 |
atccccgtgagcttaactcagttgttaaggatattgcatattatatgt |
32619394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 35683197 - 35683154
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
35683197 |
cccgtgagcttagctcagttggtagggatatcgcattttatatg |
35683154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 180 - 223
Target Start/End: Original strand, 41699640 - 41699683
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
41699640 |
ccgtgagcttagctcagttagtagggatattgcatatcatatgt |
41699683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 177 - 223
Target Start/End: Original strand, 3392465 - 3392511
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
3392465 |
tccccgtgagcttaactcagttgatatggatattgcatattatatgt |
3392511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 5073264 - 5073310
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||| |||||||||| |
|
|
| T |
5073264 |
atccccgtgagcttaactcagttggtagagatattgtatattatatg |
5073310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 7525441 - 7525487
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
7525441 |
atccccgtgagtttagttcagttggtaaggatattgcatattatatg |
7525487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 9233835 - 9233789
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| || ||||||| |
|
|
| T |
9233835 |
atccccgtgagcttaactcagttggtagggatattgaattttatatg |
9233789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 10226672 - 10226718
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
10226672 |
atccccgtgagtttagttcagttggtagggatgttgcatattatatg |
10226718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 12264055 - 12264097
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12264055 |
ccgtgaacttagctcagttggtagggatattgcattttatatg |
12264097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 12615748 - 12615794
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
12615748 |
atccccttgagcttaactcagttgatagggatattgcatattatatg |
12615794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 13720767 - 13720813
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
13720767 |
atccccgtgaagttagctcagttggttgggatattgcatattatatg |
13720813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 15694547 - 15694593
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
15694547 |
atccccgtgagcttaattcagttggtagggatattgtatattatatg |
15694593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 15701527 - 15701573
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
15701527 |
atccccgtgagcttaattcagttggtagggatattgtatattatatg |
15701573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 21762965 - 21762919
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
21762965 |
atccccgtgaacttatctcagttggtaaggatattgcatattatatg |
21762919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 23755087 - 23755041
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||| |||| |
|
|
| T |
23755087 |
atccccgtgagcttagctcaatcggtagggatattgcatattttatg |
23755041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 24188471 - 24188513
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
24188471 |
ccgtgagcatagctcagttggtagggatactgcatattatatg |
24188513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 24508823 - 24508869
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
24508823 |
atcccagtgagcgtagttcagttggtagggatattgcatattatatg |
24508869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 24880521 - 24880479
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24880521 |
ccgtaagcttagctcagttggtagggatattgaatattatatg |
24880479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 26801802 - 26801756
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
26801802 |
atccccgtgagtatagctcagttggtaggaatattgcatattatatg |
26801756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 27679083 - 27679037
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
27679083 |
atcctcgtgagcttaactcagttggtatggatattgcatattatatg |
27679037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 27704372 - 27704326
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
27704372 |
atccccgtgaacttaactcagttggtaggaatattgcatattatatg |
27704326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 182 - 220
Target Start/End: Original strand, 28735731 - 28735769
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattata |
220 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28735731 |
gtgagcttaactcagttggtagggatattgcatattata |
28735769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 32074468 - 32074422
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
32074468 |
atccccgtgagcttagctcagttggtagggatatcacattttatatg |
32074422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 35645596 - 35645642
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
35645596 |
atccccatgagcgtagctcagttggtagggatattgtatattatatg |
35645642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 38824694 - 38824652
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
38824694 |
ccgtgagcttagctcagttgatagggatattgcgtattatatg |
38824652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 177 - 223
Target Start/End: Complemental strand, 40518961 - 40518915
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
40518961 |
tccccgtgaacttagctcagttggtagggacattgcataatatatgt |
40518915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 42182267 - 42182225
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
42182267 |
ccgtgagcttaactcagttggtaggggtattgcatattatatg |
42182225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 10691 - 10650
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10691 |
cgtgatcttagcttagttggtagggatattgcatattatatg |
10650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 3529777 - 3529822
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||| |||||| |
|
|
| T |
3529777 |
atccccgtgagtttaactcagttggtagggatattgcattttatat |
3529822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 12364746 - 12364791
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||||||||| |
|
|
| T |
12364746 |
atccccgtgagcttaactcacttggtagggatattgtatattatat |
12364791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 13730164 - 13730124
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
13730164 |
gtgagcttagcttagttggtagagatattgcatattatatg |
13730124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 214
Target Start/End: Original strand, 38151347 - 38151379
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38151347 |
gtgagcttagctcagttggtagggatattgcat |
38151379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 223
Target Start/End: Complemental strand, 47287938 - 47287890
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||| ||| |||||||| |
|
|
| T |
47287938 |
gatctccgtgagcttaactcagttggtagggatattacattttatatgt |
47287890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 191 - 222
Target Start/End: Complemental strand, 1563797 - 1563766
Alignment:
| Q |
191 |
gctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1563797 |
gctcagttggtagggatattgcatattatatg |
1563766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 15655708 - 15655747
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
15655708 |
tgagcttagctcaattggtagggatattgcattttatatg |
15655747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 15716751 - 15716712
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15716751 |
tgagtttagctcagttggtagggatattgcgtattatatg |
15716712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 23817185 - 23817232
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||| ||||||||| |||| |||||||||||||||||| |||||||| |
|
|
| T |
23817185 |
atccctgtgagcttaactcaattggtagggatattgcatgttatatgt |
23817232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 28444156 - 28444109
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||| |||| ||||||| |
|
|
| T |
28444156 |
gatccccgtgagcttaactcagttggtagagatatcgcattttatatg |
28444109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 28501155 - 28501202
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||| ||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
28501155 |
atccccgtgagtttaactcagttggtatgaatattgcatattatatgt |
28501202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Complemental strand, 30004616 - 30004577
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
30004616 |
gtgaacttagctcagttggtagggatattacatattatat |
30004577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 31191670 - 31191627
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
31191670 |
cccgtgagcttaattcagttggtaaggatattgcatattatatg |
31191627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 31769582 - 31769539
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| | || |||||||||||||||||||||||||||||| |
|
|
| T |
31769582 |
cccgtgagataagttcagttggtagggatattgcatattatatg |
31769539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 32856987 - 32856944
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
32856987 |
cccgtgaacttagcttaattggtagggatattgcatattatatg |
32856944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 35612633 - 35612594
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
35612633 |
tgagcttagctcaattggtagggagattgcatattatatg |
35612594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 42798386 - 42798343
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| | ||||| ||||||||||||||||||||||| |
|
|
| T |
42798386 |
cccgtgagcttaacccagtttgtagggatattgcatattatatg |
42798343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 222
Target Start/End: Original strand, 48719807 - 48719842
Alignment:
| Q |
187 |
cttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
48719807 |
cttagctcagttggtaggaatattgcatattatatg |
48719842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 3532575 - 3532621
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| ||||| ||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
3532575 |
atcctcgtgatcttagttcagttggtagggatattgcataatatatg |
3532621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 5804852 - 5804898
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| || ||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
5804852 |
atccctgtaagcttagcttagttggtagggatattgcattttatatg |
5804898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 210
Target Start/End: Complemental strand, 6973575 - 6973541
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatatt |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6973575 |
atccccgtgagcttaactcagttggtagggatatt |
6973541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 7401456 - 7401414
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| ||| |||||||||||||||||||| |||||||||| |
|
|
| T |
7401456 |
ccgtgagtttaactcagttggtagggatattgtatattatatg |
7401414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 215
Target Start/End: Original strand, 7876001 - 7876035
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
7876001 |
cgtgagcttagctcagttggtagggacattgcata |
7876035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 11692385 - 11692431
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||| |||| |||||| |
|
|
| T |
11692385 |
atccccgtgagtttagctcagatggtagggatattacataatatatg |
11692431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 16200556 - 16200602
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||||||||||| | |||||||| ||||||||||||||||| |
|
|
| T |
16200556 |
atcccggtgagcttagcttaattggtaggaatattgcatattatatg |
16200602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 19331570 - 19331524
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
19331570 |
atccccgtgagcttagtgcagttggtacggatattgcattttatatg |
19331524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 19828127 - 19828169
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
19828127 |
ccgtgaacttagctcagttggtagggatatcgcattttatatg |
19828169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 215
Target Start/End: Complemental strand, 23274886 - 23274848
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
23274886 |
tccccgtgagcttagctaagttggtagggacattgcata |
23274848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 222
Target Start/End: Original strand, 27633940 - 27633974
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
27633940 |
ttagcttagttggtagggatattgcatattatatg |
27633974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 179 - 217
Target Start/End: Complemental strand, 29281413 - 29281375
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatatt |
217 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
29281413 |
cccgtgagcttaactcagttgatagggatattgcatatt |
29281375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 210
Target Start/End: Complemental strand, 31077976 - 31077942
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatatt |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31077976 |
atccccgtgagcttaactcagttggtagggatatt |
31077942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 215
Target Start/End: Original strand, 41853995 - 41854033
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
41853995 |
tccccgtgagcttagctcagttggcagggacattgcata |
41854033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 215
Target Start/End: Complemental strand, 47070381 - 47070343
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
47070381 |
tccccgtgagcttagctcagttggtatggacattgcata |
47070343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 223
Target Start/End: Original strand, 49089502 - 49089544
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| |||||||| |
|
|
| T |
49089502 |
cgtgagtttagctcagttgttagggatattgcatgttatatgt |
49089544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 222
Target Start/End: Complemental strand, 1398967 - 1398930
Alignment:
| Q |
185 |
agcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
1398967 |
agcttaactcagttggttgggatattgcatattatatg |
1398930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 215
Target Start/End: Original strand, 4611242 - 4611275
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
4611242 |
gtgagcttagctcagttggtagggacattgcata |
4611275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 219
Target Start/End: Original strand, 7691875 - 7691912
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattat |
219 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
7691875 |
gtgagtttagttcagttggtagggatattgcatattat |
7691912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 222
Target Start/End: Complemental strand, 15074962 - 15074929
Alignment:
| Q |
189 |
tagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
15074962 |
tagctcagttgatagggatattgcatattatatg |
15074929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 16961692 - 16961651
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||||||||||||||||||| || ||||||| |
|
|
| T |
16961692 |
cgtgagtttagctcagttggtagggatattgtattttatatg |
16961651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 222
Target Start/End: Complemental strand, 27068215 - 27068178
Alignment:
| Q |
185 |
agcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
27068215 |
agcttagctcagttggtatggataatgcatattatatg |
27068178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 222
Target Start/End: Original strand, 27210098 - 27210135
Alignment:
| Q |
185 |
agcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
27210098 |
agcttagctcagttggtatggataatgcatattatatg |
27210135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 222
Target Start/End: Complemental strand, 28602529 - 28602492
Alignment:
| Q |
185 |
agcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
28602529 |
agcttagctcagttggtaggaatattacatattatatg |
28602492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 209
Target Start/End: Complemental strand, 39182574 - 39182541
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatat |
209 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
39182574 |
atccccgtgagcttagctcagttggtatggatat |
39182541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 222
Target Start/End: Original strand, 42352648 - 42352693
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||| || |||||| |
|
|
| T |
42352648 |
tccccgtgagctttgctcagttggtagggacattgcctaatatatg |
42352693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 222
Target Start/End: Complemental strand, 45640164 - 45640119
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||| || |||| |||||||||||| |||||||||| |
|
|
| T |
45640164 |
tccccgtgagcttaacttagttagtagggatattgtatattatatg |
45640119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 209
Target Start/End: Original strand, 1649147 - 1649179
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatat |
209 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
1649147 |
tccccgtgagcatagctcagttggtagggatat |
1649179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 5579693 - 5579733
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
5579693 |
gtgagcttagctcagttggtagggacagtgcataatatatg |
5579733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 16537598 - 16537558
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||| ||||| |
|
|
| T |
16537598 |
cgtgagtttagctcagttggtagggataatgcataatatat |
16537558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 16628064 - 16628104
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||| ||||| |
|
|
| T |
16628064 |
cgtgagtttagctcagttggtagggataatgcataatatat |
16628104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 223
Target Start/End: Complemental strand, 20115642 - 20115602
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||| ||||||||||||||||||| | |||||||||||||| |
|
|
| T |
20115642 |
tgagtttagctcagttggtagggacaatgcatattatatgt |
20115602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 222
Target Start/End: Complemental strand, 28424394 - 28424358
Alignment:
| Q |
186 |
gcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
28424394 |
gcttagctcagtttgtagggaaattgcatattatatg |
28424358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 34051941 - 34051901
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
34051941 |
gtgagtttagttcagttggtagtgatattgcatattatatg |
34051901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 44377112 - 44377072
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
44377112 |
gtgagcttaactcagttggtagagatattacatattatatg |
44377072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 44385979 - 44385939
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
44385979 |
gtgagcttaactcagttggtagagatattacatattatatg |
44385939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 219
Target Start/End: Complemental strand, 47255152 - 47255112
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattat |
219 |
Q |
| |
|
|||||||||||| ||||||||| || ||||||||||||||| |
|
|
| T |
47255152 |
cccgtgagcttaactcagttggcagagatattgcatattat |
47255112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 48413993 - 48413953
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||||| |
|
|
| T |
48413993 |
gtgagcttagctcaattggcagagatattgcatattatatg |
48413953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 49053998 - 49054038
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||||||||| | ||||||||||||||||| |
|
|
| T |
49053998 |
gtgagcttagttcagttggtacgaatattgcatattatatg |
49054038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 179)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 171 - 222
Target Start/End: Original strand, 37935853 - 37935904
Alignment:
| Q |
171 |
tgtcgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37935853 |
tgtcgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
37935904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 3847677 - 3847724
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3847677 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
3847724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 6371110 - 6371157
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6371110 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
6371157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 24680160 - 24680113
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24680160 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
24680113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 40051619 - 40051666
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40051619 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
40051666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 8965091 - 8965137
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8965091 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
8965137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 26868346 - 26868392
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26868346 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
26868392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 26919541 - 26919495
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26919541 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
26919495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 39023172 - 39023218
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39023172 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
39023218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 43147457 - 43147411
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43147457 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
43147411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 43207666 - 43207712
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43207666 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
43207712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 43596892 - 43596938
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43596892 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
43596938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 46105532 - 46105578
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46105532 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
46105578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 46775103 - 46775057
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46775103 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
46775057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 48569249 - 48569203
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48569249 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
48569203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 49901479 - 49901525
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49901479 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
49901525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 55251424 - 55251378
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55251424 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
55251378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 8433696 - 8433651
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8433696 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
8433651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 40994173 - 40994129
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40994173 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
40994129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 3036129 - 3036082
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3036129 |
gatccccgtgagcttaactcagttggtagggatattgcatattatatg |
3036082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 22230504 - 22230461
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22230504 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
22230461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 22788744 - 22788701
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22788744 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
22788701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 43978008 - 43978051
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43978008 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
43978051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 3764081 - 3764035
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3764081 |
atccccgtgagcttagctcagttggtagggatattacatattatatg |
3764035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 4234358 - 4234312
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4234358 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
4234312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 4958629 - 4958583
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4958629 |
atccccgtgagcttagttcagttggtagggatattgcatattatatg |
4958583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 9761112 - 9761158
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9761112 |
atccccgtgagcttacctcagttggtagggatattgcatattatatg |
9761158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 11375962 - 11375916
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11375962 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
11375916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 218
Target Start/End: Complemental strand, 23705226 - 23705184
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatatta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23705226 |
atccccgtgagcttagctcagttggtagggatattgcatatta |
23705184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 25235870 - 25235824
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25235870 |
atccccgtgagcttagcttagttggtagggatattgcatattatatg |
25235824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 30217600 - 30217642
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30217600 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
30217642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 34353780 - 34353822
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34353780 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
34353822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 218
Target Start/End: Complemental strand, 35219573 - 35219531
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatatta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35219573 |
atccccgtgagcttagctcagttggtagggatattgcatatta |
35219531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 35465431 - 35465477
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35465431 |
gatccccgtgagcttagctcagttggtagggatattgcattttatat |
35465477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 181 - 223
Target Start/End: Complemental strand, 39696405 - 39696363
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39696405 |
cgtgagcttagctcagttggtagggatattgcatattatatgt |
39696363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 44602482 - 44602528
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44602482 |
atccccgtgagcttagctcagttggtagggatattgcattttatatg |
44602528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 45112184 - 45112138
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45112184 |
atccccgtgagcttacctcagttggtagggatattgcatattatatg |
45112138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 45126129 - 45126175
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45126129 |
atccccgtgagcttagctcagttggtagggatattgtatattatatg |
45126175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 45849044 - 45849090
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45849044 |
atccccgtgagcttagctcagttggtagggatattgcatattttatg |
45849090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 47934145 - 47934099
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47934145 |
atccccgtgagcttagctcagttggtagggatatggcatattatatg |
47934099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 51512082 - 51512036
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51512082 |
atccccgtgagctgagctcagttggtagggatattgcatattatatg |
51512036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 52798275 - 52798321
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52798275 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
52798321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 55238572 - 55238526
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
55238572 |
atccccgtgagcttagcttagttggtagggatattgcatattatatg |
55238526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 55536377 - 55536423
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
55536377 |
atccccgtgagcttagctcagttggtaaggatattgcatattatatg |
55536423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 55853181 - 55853135
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
55853181 |
atccccgtgagcttagctcagttggtagagatattgcatattatatg |
55853135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 4590243 - 4590288
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4590243 |
atccccgtgagtttagctcagttggtagggatattgcatattatat |
4590288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 176 - 220
Target Start/End: Original strand, 42218747 - 42218791
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattata |
220 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42218747 |
atccccgtgaacttagctcagttggtagggatattgcatattata |
42218791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 176 - 220
Target Start/End: Original strand, 48798276 - 48798320
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattata |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48798276 |
atccccgtgagcttagctcagttggtagggatattgcattttata |
48798320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 637095 - 637142
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
637095 |
gatccccgtgagcttagctcagctggtaggaatattgcatattatatg |
637142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 3815060 - 3815103
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3815060 |
cccgtgagcttagcttagttggtagggatattgcatattatatg |
3815103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 13578539 - 13578492
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13578539 |
gatctccgtgagcttaactcagttggtagggatattgcatattatatg |
13578492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 21935473 - 21935520
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21935473 |
gatccccgcaagcttagctcagttggtagggatattgcatattatatg |
21935520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 27743778 - 27743735
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27743778 |
cccgtgagcgtagctcagttggtagggatattgcatattatatg |
27743735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 31852686 - 31852639
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
31852686 |
atccccgtgagcttatctcagttggtagggttattgcatattatatgt |
31852639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 39697932 - 39697889
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39697932 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
39697889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 49447118 - 49447165
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49447118 |
atccccatgagcttagctcagttggtaaggatattgcatattatatgt |
49447165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 50457784 - 50457741
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50457784 |
cccgtgagcttagctcagttggtaaggatattgcatattatatg |
50457741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 1458091 - 1458045
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1458091 |
atccccgtaagcttagctcagttgatagggatattgcatattatatg |
1458045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 3157290 - 3157244
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3157290 |
atccccgtgaacttagctcagttggtaggaatattgcatattatatg |
3157244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 5165854 - 5165900
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
5165854 |
atccccgtgagcttaactcagttggtagggatatcgcatattatatg |
5165900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 7686335 - 7686289
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
7686335 |
atccccgtgagcttagctcagttggtagagatattgcattttatatg |
7686289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 10402438 - 10402484
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
10402438 |
atccccgtgagcttaactcagttggtagagatattgcatattatatg |
10402484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 10417294 - 10417248
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10417294 |
atccccatgagcttagctcagttggtagggatattacatattatatg |
10417248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 12504716 - 12504670
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12504716 |
atcctcgtgagcttatctcagttggtagggatattgcatattatatg |
12504670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 13264347 - 13264301
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13264347 |
atccccatgagcttcgctcagttggtagggatattgcatattatatg |
13264301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 177 - 223
Target Start/End: Original strand, 42395225 - 42395271
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42395225 |
tccctgtgagcttagcttagttggtagggatattgcatattatatgt |
42395271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 45673649 - 45673695
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
45673649 |
atccccgtgagcttaactcagttggtaggaatattgcatattatatg |
45673695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 46582631 - 46582677
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46582631 |
atccctgtgagtttagctcagttggtagggatattgcatattatatg |
46582677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 49757357 - 49757311
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
49757357 |
atccccgtgagcatagctcagttggtaggaatattgcatattatatg |
49757311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 50512357 - 50512403
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50512357 |
atccccatgagcttagctcagttggtaggaatattgcatattatatg |
50512403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 52757351 - 52757305
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
52757351 |
atccccgtgagcttagctcagttggcaggaatattgcatattatatg |
52757305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 15208519 - 15208564
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
15208519 |
atccccgtgagcttaactcagtgggtagggatattgcatattatat |
15208564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 180 - 221
Target Start/End: Complemental strand, 25726378 - 25726337
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25726378 |
ccgtgggcttagctcagttggtagggatattgcatattatat |
25726337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 29771367 - 29771326
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29771367 |
cgtgagcttagctcaattggtagggatattgcatattatatg |
29771326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 177 - 222
Target Start/End: Complemental strand, 33933811 - 33933766
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
33933811 |
tccccgtgagcttagctcagttggtagggacattgcataatatatg |
33933766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 177 - 222
Target Start/End: Original strand, 37251111 - 37251156
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
37251111 |
tccccgtgagcttaactcagttggtagggatattgcatattttatg |
37251156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 627049 - 627009
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
627049 |
gtgagtttagctcagttggtagggatattgcatattatatg |
627009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 18424967 - 18424923
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18424967 |
cccgtgaacttaactcagttggtagggatattgcatattatatgt |
18424923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 179 - 219
Target Start/End: Complemental strand, 24997504 - 24997464
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24997504 |
cccgtgagcttagctcagttggtagggatattgcattttat |
24997464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 42381183 - 42381139
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42381183 |
cccgtgaacttagctcagttggtagggatattgcatgttatatgt |
42381139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 4105727 - 4105770
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
4105727 |
cccgtgagcttagctcagttgatagggatattgcattttatatg |
4105770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 4357879 - 4357926
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
4357879 |
atccccgtgaacttagctcagttggtagagatattgtatattatatgt |
4357926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 182 - 221
Target Start/End: Complemental strand, 8848279 - 8848240
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8848279 |
gtgagcttagttcagttggtagggatattgcatattatat |
8848240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 15604110 - 15604067
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
15604110 |
cccgtgagcttagctcagttggtagggatgttgcattttatatg |
15604067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 180 - 223
Target Start/End: Complemental strand, 27103170 - 27103127
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27103170 |
ccgtgtgcttagcttagttggtagggatattgcatattatatgt |
27103127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 29329896 - 29329849
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| || |||||||| |
|
|
| T |
29329896 |
atccccgtgagcttagctcagttggtaggaatattgtattttatatgt |
29329849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 33530790 - 33530837
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||| ||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
33530790 |
atcctcgtgagcttagcttaattggtagggatattgcatattatatgt |
33530837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 36132225 - 36132272
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||| |||||||| ||||||||||||||||| |
|
|
| T |
36132225 |
gatccccgtgagtttagctcaattggtaggaatattgcatattatatg |
36132272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 174 - 221
Target Start/End: Complemental strand, 37700674 - 37700627
Alignment:
| Q |
174 |
cgatccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||||||| ||| ||| |||||||||||||||||||||||||| |
|
|
| T |
37700674 |
cgatccccgtgagtttacctcggttggtagggatattgcatattatat |
37700627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 180 - 223
Target Start/End: Original strand, 38228438 - 38228481
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
38228438 |
ccgtgagcttagatcagttggtagggatattgcatgttatatgt |
38228481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 42231512 - 42231555
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
42231512 |
cccgtgagcttaactcagttggtaggaatattgcatattatatg |
42231555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 44312854 - 44312811
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44312854 |
cccgcgagcttagctcagttggtagggatattgcattttatatg |
44312811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 48615542 - 48615499
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
48615542 |
cccgtgagcataactcagttggtagggatattgcatattatatg |
48615499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 52483249 - 52483203
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
52483249 |
atccccgtgagcttagctcagttggta-ggatgttgcatattatatgt |
52483203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 56360785 - 56360738
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
56360785 |
atccccgtgaatttagctcagttggtagggatattgcgtattatatgt |
56360738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 542883 - 542841
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
542883 |
ccgtgagcttagctcagttgatagggatattgcatattgtatg |
542841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 5179955 - 5179909
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
5179955 |
atccccgtgaacttaactcagttggtaaggatattgcatattatatg |
5179909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 12167689 - 12167643
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12167689 |
atccctgtgaacttaactcagttggtagggatattgcatattatatg |
12167643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 12763752 - 12763798
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||| | ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12763752 |
gatccccgtaaacttagctcagttgctagggatattgcatattatat |
12763798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 18360490 - 18360536
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
18360490 |
atccccgtgagcttagctcagttggtagggatatcacattttatatg |
18360536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 23787412 - 23787366
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
23787412 |
atccctgtgagcataactcagttggtagggatattgcatattatatg |
23787366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 35207220 - 35207178
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
35207220 |
ccgtgagcttaactcagttgatagggatattgcatattatatg |
35207178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 36602439 - 36602393
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
36602439 |
atccccgtgagcttagctcagttggtagggatatcacattttatatg |
36602393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 43271786 - 43271744
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
43271786 |
ccgtgagcttagttcagttgatagggatattgcatattatatg |
43271744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 43481112 - 43481066
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
43481112 |
atccccgtgagcttaactcagttggtagggatattgcactttatatg |
43481066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 50442814 - 50442768
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
50442814 |
atccctgtgagcttagctcagttggtagggataatgcataatatatg |
50442768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 53376752 - 53376706
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
53376752 |
atccccgcgagcttagctcaattggtagggatattgcatgttatatg |
53376706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 53572396 - 53572354
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
53572396 |
ccgtgagcttaactcagttgatagggatattgcatattatatg |
53572354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 222
Target Start/End: Original strand, 54534835 - 54534869
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
54534835 |
ttagctcagttggtagggatattgcatattatatg |
54534869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 56088027 - 56087981
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
56088027 |
atccccataagcttagctcagttggtagggatattgcattttatatg |
56087981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 182 - 223
Target Start/End: Complemental strand, 10407101 - 10407061
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10407101 |
gtgagcttagctcagttggta-ggatattgcatattatatgt |
10407061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 15064270 - 15064229
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15064270 |
cgtgagtttagctcagttggtaggaatattgcatattatatg |
15064229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 17872084 - 17872129
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||| ||||| |
|
|
| T |
17872084 |
atccccgtgagcttagcttaattggtagggatattgcatagtatat |
17872129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 20203428 - 20203469
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
20203428 |
cgtgagcttagctcatttggtagagatattgcatattatatg |
20203469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 222
Target Start/End: Original strand, 30057232 - 30057265
Alignment:
| Q |
189 |
tagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30057232 |
tagctcagttggtagggatattgcatattatatg |
30057265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 53634324 - 53634279
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||| ||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
53634324 |
atccccatgagcttagttcagttcgtagggatattgcatattatat |
53634279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 177 - 222
Target Start/End: Original strand, 55055914 - 55055959
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||| |||| |
|
|
| T |
55055914 |
tccccgtgagcttagctcagttggtagggacaatgcatattttatg |
55055959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 56479294 - 56479253
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
56479294 |
cgtgaacttaactcagttggtagggatattgcatattatatg |
56479253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 223
Target Start/End: Complemental strand, 8144653 - 8144617
Alignment:
| Q |
187 |
cttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8144653 |
cttagctcagtttgtagggatattgcatattatatgt |
8144617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 9661550 - 9661594
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||| ||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
9661550 |
cccgtgagtttatctcagttggtatggatattgcatattatatgt |
9661594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 223
Target Start/End: Complemental strand, 10042491 - 10042444
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||| |||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
10042491 |
gatccgcgtgagct-agttcagttggtagggatattgcatattatatgt |
10042444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 17815492 - 17815452
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
17815492 |
gtgagcttagttcagttggtagggatattacatattatatg |
17815452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 223
Target Start/End: Original strand, 19594229 - 19594277
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||| |||||||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
19594229 |
gatcctcgtgagcttaactcagttgatagagatattgcatattatatgt |
19594277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 176 - 220
Target Start/End: Complemental strand, 21380255 - 21380211
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattata |
220 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
21380255 |
atccccgtgagtttagctcaattgctagggatattgcatattata |
21380211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 21432616 - 21432656
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
21432616 |
cgtgagcttagttcagttggtagagatattgcatattatat |
21432656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 25175197 - 25175157
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
25175197 |
gtgagcttagttcagttggtagggatattacatattatatg |
25175157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 183 - 223
Target Start/End: Original strand, 25526447 - 25526487
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
25526447 |
tgagcttaactcagttggtagggatattgtatattatatgt |
25526487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 191 - 223
Target Start/End: Original strand, 31016348 - 31016380
Alignment:
| Q |
191 |
gctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31016348 |
gctcagttggtagggatattgcatattatatgt |
31016380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 49056774 - 49056818
Alignment:
| Q |
179 |
cccgtgagctta-gctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
49056774 |
cccgtgagcttaagctcagttggtagggacattgcatattatatg |
49056818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 921552 - 921505
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||| |||||||||||||||| ||| |||| |||||||||||||| |
|
|
| T |
921552 |
atccccgcgagcttagctcagttgatagagataatgcatattatatgt |
921505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 1439618 - 1439661
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| |||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
1439618 |
cccgtgaacttagctcagttggtatggacattgcatattatatg |
1439661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 180 - 215
Target Start/End: Complemental strand, 2609462 - 2609427
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2609462 |
ccgtaagcttagctcagttggtagggatattgcata |
2609427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 180 - 215
Target Start/End: Original strand, 3784913 - 3784948
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3784913 |
ccgtgagcttagctcaattggtagggatattgcata |
3784948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 4701004 - 4700965
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
4701004 |
tgagtttagctcagttggtagggatattgtatattatatg |
4700965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 188 - 223
Target Start/End: Original strand, 12267527 - 12267562
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12267527 |
ttagctcagttggtagagatattgcatattatatgt |
12267562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 12582098 - 12582055
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| | || |||||||||||||||||||||||||||| |
|
|
| T |
12582098 |
cccgtgagctaatcttagttggtagggatattgcatattatatg |
12582055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 224
Target Start/End: Original strand, 33107362 - 33107401
Alignment:
| Q |
185 |
agcttagctcagttggtagggatattgcatattatatgtg |
224 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
33107362 |
agcttagctcagttggtaaggatattgtatattatatgtg |
33107401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 42134523 - 42134484
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
42134523 |
tgagcttaactcagttagtagggatattgcatattatatg |
42134484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 216
Target Start/End: Complemental strand, 47230973 - 47230938
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatat |
216 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47230973 |
cgtgagcttagctcagttggtagagatattgcatat |
47230938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 207
Target Start/End: Original strand, 48949650 - 48949681
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48949650 |
atccccgtgagcttagctcagttggtagggat |
48949681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 223
Target Start/End: Complemental strand, 481609 - 481571
Alignment:
| Q |
185 |
agcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
481609 |
agcttagcttagttggtagagatattgcatattatatgt |
481571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 2688096 - 2688139
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2688096 |
gatccccgtgagcttagct----tggtagggatattgcatattatatg |
2688139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 2771037 - 2771079
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||| || || ||||||||||||||||||| |
|
|
| T |
2771037 |
ccgtgagcttagctcagctgatatggatattgcatattatatg |
2771079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 7657060 - 7657106
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||| |||| ||| |||||||||| |
|
|
| T |
7657060 |
atccccgtgagcttatctcagttggtaaggatgttgtatattatatg |
7657106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 223
Target Start/End: Complemental strand, 19933860 - 19933826
Alignment:
| Q |
189 |
tagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
19933860 |
tagctcagttggtagggataatgcatattatatgt |
19933826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 21116778 - 21116824
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||||||| || | ||||||||||||||||| |
|
|
| T |
21116778 |
atccccgtgagcttaactcagttgttaagaatattgcatattatatg |
21116824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 27362898 - 27362856
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
27362898 |
ccgtgagcttaactcagttggtagcgatattacatattatatg |
27362856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 223
Target Start/End: Original strand, 32006499 - 32006541
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
32006499 |
cgtgagtttagctcagttggtagggataatgcataatatatgt |
32006541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 222
Target Start/End: Original strand, 32339329 - 32339367
Alignment:
| Q |
184 |
gagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
32339329 |
gagcttaactcagttgttagggatattgcatattatatg |
32339367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 223
Target Start/End: Original strand, 34932497 - 34932539
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
34932497 |
cgtgagcttagctcagttggtaggaatattgcacgttatatgt |
34932539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 223
Target Start/End: Original strand, 36215322 - 36215364
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
36215322 |
cgtgagcttagatcagttgatagggatattgtatattatatgt |
36215364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 223
Target Start/End: Original strand, 37310029 - 37310071
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||| ||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
37310029 |
cgtgagtttaactcagttggtatggatattgcatattatatgt |
37310071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 179 - 221
Target Start/End: Complemental strand, 37921111 - 37921069
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||| |||||| |
|
|
| T |
37921111 |
cccgtgaggttagctcagttggttgggatattgcattttatat |
37921069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 47890692 - 47890738
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| | | |||||||||||| |||||||||||||||||| |
|
|
| T |
47890692 |
atccccgtgagttaaactcagttggtagagatattgcatattatatg |
47890738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 48744205 - 48744251
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48744205 |
atccccatgagcttagctcagttggtagggatataatatattatatg |
48744251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 215
Target Start/End: Original strand, 52015489 - 52015527
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
52015489 |
tccccgtgagcttagctcagttggcagggacattgcata |
52015527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 54103637 - 54103591
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| | ||| |||||||| |||||||||||||||||||||| |
|
|
| T |
54103637 |
atccccgtgcgtttaactcagttgatagggatattgcatattatatg |
54103591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 222
Target Start/End: Original strand, 55021563 - 55021597
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
55021563 |
ttagctcagttggtaggaatattgcatattatatg |
55021597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 55531251 - 55531297
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||| |||| ||||||| |
|
|
| T |
55531251 |
atccccgtaagcttagctcagttggtggggatatcgcattttatatg |
55531297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 922321 - 922276
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||| || |||||||||||||||| | ||||||||||||||| |
|
|
| T |
922321 |
atccccgtaagtttagctcagttggtagaggtattgcatattatat |
922276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 2034162 - 2034117
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
2034162 |
atccccgtgagtttagctcagttggtatggataatgcataatatat |
2034117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 206
Target Start/End: Original strand, 3161019 - 3161048
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtaggga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3161019 |
tccccgtgagcttagctcagttggtaggga |
3161048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 223
Target Start/End: Complemental strand, 8061978 - 8061937
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| ||||||||| |
|
|
| T |
8061978 |
gtgagcttaactcagttggtcgggatattgcagattatatgt |
8061937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 222
Target Start/End: Complemental strand, 12775299 - 12775266
Alignment:
| Q |
189 |
tagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
12775299 |
tagctcagttggtagggatattgcattttatatg |
12775266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 16193244 - 16193199
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||||| ||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
16193244 |
atccccgtgagtttaactcagttggtaaggatattgtatattatat |
16193199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 20799456 - 20799415
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
20799456 |
cgtgagcttagctcagttggtagggacaatgcataatatatg |
20799415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 22654107 - 22654062
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||| |||||||||||||| |||||||| ||||||||| |||||| |
|
|
| T |
22654107 |
atccctgtgagcttagctcaattggtaggaatattgcattttatat |
22654062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 223
Target Start/End: Complemental strand, 35851768 - 35851727
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| ||||||| |
|
|
| T |
35851768 |
gtgagcttaactcagttggtagggacattgcataatatatgt |
35851727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 178 - 215
Target Start/End: Original strand, 42002305 - 42002342
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
42002305 |
ccccgtgagcttagcttagttggtagggacattgcata |
42002342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 50362201 - 50362160
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
50362201 |
cgtgagcttagctcagttggtagggacaatgcataatatatg |
50362160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 178 - 215
Target Start/End: Original strand, 51890796 - 51890833
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
51890796 |
ccccgtgagcttagctcagttggcagggacattgcata |
51890833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 38416057 - 38416097
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||| |||||| |
|
|
| T |
38416057 |
gtgagcttagctcagttggtaaggataatgcataatatatg |
38416097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 211
Target Start/End: Complemental strand, 45139951 - 45139919
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
45139951 |
cccgtgagcttagctcagttggtagggacattg |
45139919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 214
Target Start/End: Original strand, 46206580 - 46206612
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcat |
214 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
46206580 |
gtgagcttagctcagttggtagggacattgcat |
46206612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 46998435 - 46998395
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||| | |||||| |||||||||| |
|
|
| T |
46998435 |
gtgagcttagctcagttggtatgaatattgtatattatatg |
46998395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 215
Target Start/End: Complemental strand, 47678663 - 47678627
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
47678663 |
cccgtgagcttagttcagttggtagggacattgcata |
47678627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 224
Target Start/End: Original strand, 49022959 - 49023007
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgtg |
224 |
Q |
| |
|
||||| |||| |||| ||||||||||||| ||||||||||||| ||||| |
|
|
| T |
49022959 |
atccctgtgaacttaactcagttggtaggaatattgcatattagatgtg |
49023007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 215
Target Start/End: Complemental strand, 50279110 - 50279074
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
50279110 |
cccgcgagcttagctcagttggtagggacattgcata |
50279074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 222
Target Start/End: Complemental strand, 54443943 - 54443907
Alignment:
| Q |
186 |
gcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||| |
|
|
| T |
54443943 |
gcttagcttaggtggtagggatattgcatattatatg |
54443907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 9e-20; HSPs: 159)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 173 - 222
Target Start/End: Original strand, 33254722 - 33254771
Alignment:
| Q |
173 |
tcgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33254722 |
tcgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
33254771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 173 - 222
Target Start/End: Original strand, 33274894 - 33274943
Alignment:
| Q |
173 |
tcgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33274894 |
tcgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
33274943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 7166301 - 7166254
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7166301 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
7166254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 42054330 - 42054377
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42054330 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
42054377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 42490484 - 42490437
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42490484 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
42490437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 50899584 - 50899537
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50899584 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
50899537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 1570265 - 1570219
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1570265 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
1570219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 3269616 - 3269662
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3269616 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
3269662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 4482671 - 4482625
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4482671 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
4482625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 6438137 - 6438091
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6438137 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
6438091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 6702573 - 6702619
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6702573 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
6702619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 8865851 - 8865897
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8865851 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
8865897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 10664867 - 10664821
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10664867 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
10664821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 15819674 - 15819628
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15819674 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
15819628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 21265653 - 21265699
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21265653 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
21265699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 22563383 - 22563429
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22563383 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
22563429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 25999847 - 25999893
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25999847 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
25999893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 26584819 - 26584773
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26584819 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
26584773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 32594248 - 32594294
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32594248 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
32594294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 33207202 - 33207248
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33207202 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
33207248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 35605696 - 35605650
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35605696 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
35605650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 40519617 - 40519571
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40519617 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
40519571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 46965737 - 46965783
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46965737 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
46965783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 1151756 - 1151801
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1151756 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
1151801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 178 - 222
Target Start/End: Original strand, 16343027 - 16343071
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16343027 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
16343071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 9866254 - 9866211
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9866254 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
9866211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 1836500 - 1836546
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1836500 |
atccccgtgagcttagctcagttggtagggatattacatattatatg |
1836546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 2277755 - 2277797
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2277755 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
2277797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 2556553 - 2556599
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2556553 |
atccccgtaagcttagctcagttggtagggatattgcatattatatg |
2556599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 2754357 - 2754403
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2754357 |
atccccgtgagcttagcttagttggtagggatattgcatattatatg |
2754403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 6130106 - 6130060
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6130106 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
6130060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 6893310 - 6893264
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6893310 |
atccccgtgagcttagctcagttggtagggatattgcattttatatg |
6893264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 11215002 - 11215044
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11215002 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
11215044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 13773165 - 13773211
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13773165 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
13773211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 16526250 - 16526204
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16526250 |
atccccgtgagcttagctcaattggtagggatattgcatattatatg |
16526204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 18467271 - 18467225
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18467271 |
atccccgtgagcatagctcagttggtagggatattgcatattatatg |
18467225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 18551706 - 18551660
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18551706 |
atccccgtgagcttagctcagttggtatggatattgcatattatatg |
18551660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 34058215 - 34058257
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34058215 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
34058257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 37662630 - 37662584
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37662630 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatg |
37662584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 40375388 - 40375342
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40375388 |
atccccgtgagcatagctcagttggtagggatattgcatattatatg |
40375342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 40520827 - 40520873
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40520827 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
40520873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 43884791 - 43884837
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43884791 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
43884837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 44732630 - 44732676
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44732630 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
44732676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 47402736 - 47402690
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47402736 |
atccccgtgagcttagctcagctggtagggatattgcatattatatg |
47402690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 48638529 - 48638575
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48638529 |
atccccgtgagcttagctcagttggtagggatattgcattttatatg |
48638575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 51050187 - 51050233
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
51050187 |
atccccgtgagcttagctcagttggtagggatattgtatattatatg |
51050233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 180 - 223
Target Start/End: Original strand, 18534002 - 18534045
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18534002 |
ccgtgagcttagctcagttggtagagatattgcatattatatgt |
18534045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 178 - 221
Target Start/End: Original strand, 27818568 - 27818611
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27818568 |
ccccctgagcttagctcagttggtagggatattgcatattatat |
27818611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 32556999 - 32556956
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32556999 |
cccgtgagcttagctcagctggtagggatattgcatattatatg |
32556956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 47478921 - 47478874
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47478921 |
atcctcgtgagcttaactcagttggtagggatattgcatattatatgt |
47478874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 2352638 - 2352592
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
2352638 |
atccccgtgagcttagctcagttgatagagatattgcatattatatg |
2352592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 7180687 - 7180641
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7180687 |
atccccgtgaggttagctcagttggtaggaatattgcatattatatg |
7180641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 8415726 - 8415772
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8415726 |
atccacgtgagcttagctcagttcgtagggatattgcatattatatg |
8415772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 12502327 - 12502281
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12502327 |
atccccgtaagcatagctcagttggtagggatattgcatattatatg |
12502281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 18216903 - 18216949
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
18216903 |
atccccgtgagcttagctcagttggtagggatattacatattttatg |
18216949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 19011356 - 19011398
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19011356 |
ccgtgagcttagctcaattggtagggatattgcatattatatg |
19011398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 23545527 - 23545481
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
23545527 |
atccccgtgagctaagcttagttggtagggatattgcatattatatg |
23545481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 26550491 - 26550537
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
26550491 |
atccccgtgagcttaactcagttggtagggatattgcatactatatg |
26550537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 29188633 - 29188679
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29188633 |
atccccgtgattttagctcagttggtagggatattgcatattatatg |
29188679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 52426982 - 52426940
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52426982 |
ccgtgagcttagctcagttgatagggatattgcatattatatg |
52426940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 182 - 223
Target Start/End: Complemental strand, 3694982 - 3694941
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3694982 |
gtgagcttagctcagttggaagggatattgcatattatatgt |
3694941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 42299581 - 42299540
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42299581 |
cgtgagcttagttcagttggtagggatattgcatattatatg |
42299540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 52369599 - 52369640
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
52369599 |
cgtgagtttagctcagttggtagggatattgcatattatatg |
52369640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 179 - 215
Target Start/End: Original strand, 24874971 - 24875007
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24874971 |
cccgtgagcttagctcagttggtagggatattgcata |
24875007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 25034904 - 25034948
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
25034904 |
cccgtgagcttagctcagttggtaggaatattgcattttatatgt |
25034948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 176 - 216
Target Start/End: Complemental strand, 45333784 - 45333744
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatat |
216 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45333784 |
atccccgtgagcttagctcagttggcagggatattgcatat |
45333744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 46225390 - 46225430
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46225390 |
gtgagcttagctcagttggtagggatattgcattttatatg |
46225430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 14760822 - 14760778
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14760822 |
atccccgtgagcttagctcagttggta--gatattgcatattatatg |
14760778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 218
Target Start/End: Original strand, 15390220 - 15390259
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatatta |
218 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
15390220 |
cccgtgagcttaactcagttggtagggatattgcatatta |
15390259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 15775739 - 15775782
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
15775739 |
cccgtgagcttaactcaattggtagggatattgcatattatatg |
15775782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 27344476 - 27344523
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27344476 |
atcctcgtgagcttagctcagttggtagacatattgcatattatatgt |
27344523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 42848797 - 42848758
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42848797 |
tgagcttagctcagttgatagggatattgcatattatatg |
42848758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 46161189 - 46161150
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46161189 |
tgagcttagctcagttggtaggaatattgcatattatatg |
46161150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 51933510 - 51933549
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
51933510 |
tgagcttagctcaattggtagggatattgcatattatatg |
51933549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 4553619 - 4553573
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
4553619 |
atccccgtgagcttaactcagttggtagaaatattgcatattatatg |
4553573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 5190854 - 5190808
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
5190854 |
atccccatgagcttagctcaattggtagggatatcgcatattatatg |
5190808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 6463109 - 6463063
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
6463109 |
atccccatgagcttagctcagttggtagggatattgtattttatatg |
6463063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 7191033 - 7191075
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7191033 |
ccgtgaccttagctcagttgatagggatattgcatattatatg |
7191075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 8984574 - 8984532
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
8984574 |
ccgtgagcttaactcagttggcagggatattgcatattatatg |
8984532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 11065117 - 11065163
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||| || ||| |||||||||||||||||| |
|
|
| T |
11065117 |
atccccgtgagcttagctcagatgatagagatattgcatattatatg |
11065163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 12404353 - 12404399
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||| ||| |||||||||||||||||||||||||| |
|
|
| T |
12404353 |
atccccgtgagattagatcaattggtagggatattgcatattatatg |
12404399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 13538519 - 13538473
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13538519 |
atcccagtgaacttagttcagttggtagggatattgcatattatatg |
13538473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 181 - 223
Target Start/End: Original strand, 14349646 - 14349688
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14349646 |
cgtgaacttagctcagttggtagagatattgcatattatatgt |
14349688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 15595726 - 15595768
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
15595726 |
ccgtgagcttagctcagttggtagggacattgcataatatatg |
15595768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 16182199 - 16182241
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
16182199 |
ccgtgagcttagctgagttggtagagatattgcatattatatg |
16182241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 214
Target Start/End: Complemental strand, 17671483 - 17671445
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17671483 |
atccccgtgagcttagctcagttggtagggatatcgcat |
17671445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 25580689 - 25580731
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
25580689 |
ccgtgagcttaactcagttggtagagatattgcatattatatg |
25580731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 27650694 - 27650740
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
27650694 |
atcctcgtgagctaagttcagttggtagggatattgcatattatatg |
27650740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 28867480 - 28867522
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28867480 |
ccgtgaacttagctcagttggtaggaatattgcatattatatg |
28867522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 33033127 - 33033169
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33033127 |
ccgtgagcttaattcagttggtagggatattgcatattatatg |
33033169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 34271841 - 34271887
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
34271841 |
atccccgtgagtttagctcagctggtagggatattacatattatatg |
34271887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 34580859 - 34580813
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||| |||||||||| |
|
|
| T |
34580859 |
atccccgtgagttcagctcagttggtagggatattgtatattatatg |
34580813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 43668030 - 43667984
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| |||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
43668030 |
atccccgtaagcttagctcagttcgtagagatattgcatattatatg |
43667984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 44019277 - 44019319
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
44019277 |
ccgtgagcttagctcagttgatagggatattgcattttatatg |
44019319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 45271763 - 45271809
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| | ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45271763 |
atccccgttaacttagttcagttggtagggatattgcatattatatg |
45271809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 46021952 - 46021906
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
46021952 |
atccccgtgagcgtagctcagtaagtagggatattgcatattatatg |
46021906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 48897190 - 48897144
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||| |||||||| ||||||||||||||||| |
|
|
| T |
48897190 |
atccccgtgagcttaactcatttggtaggaatattgcatattatatg |
48897144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 6712177 - 6712136
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
6712177 |
cgtgagcttagctcagttggtaggtatattgcattttatatg |
6712136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 177 - 222
Target Start/End: Complemental strand, 12650456 - 12650411
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
12650456 |
tccccgtgaacttagctcagttggtaaggatattgcatgttatatg |
12650411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 222
Target Start/End: Complemental strand, 27642790 - 27642753
Alignment:
| Q |
185 |
agcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27642790 |
agcttagctcagttggtagggatattgcattttatatg |
27642753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 31762069 - 31762024
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||| ||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
31762069 |
atcccagtgagcttagctcagttggcagtgatattgcatattatat |
31762024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 178 - 215
Target Start/End: Complemental strand, 36666647 - 36666610
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36666647 |
ccccgtgagcttagctcagttggtagggacattgcata |
36666610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 180 - 221
Target Start/End: Complemental strand, 45517337 - 45517296
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
45517337 |
ccgtgagcttagttcagttggtagggatattgcattttatat |
45517296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 222
Target Start/End: Complemental strand, 47930731 - 47930698
Alignment:
| Q |
189 |
tagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47930731 |
tagctcagttggtagggatattgcatattatatg |
47930698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 222
Target Start/End: Original strand, 10851819 - 10851867
Alignment:
| Q |
174 |
cgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||||||||||||| |||||| |||||||| |||||||||| |
|
|
| T |
10851819 |
cgatcctcgtgagcttagctcaattggtaaggatattgtatattatatg |
10851867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 17580320 - 17580360
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17580320 |
gtgaacttagctcagttggtagggatattgcatgttatatg |
17580360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 178 - 222
Target Start/End: Original strand, 49253609 - 49253652
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
49253609 |
ccccgtgagcttagctaagttggta-ggatattgcatattatatg |
49253652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 923174 - 923131
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
923174 |
cccgtgaatttagcgcagttggtagggatattgcatattatatg |
923131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Original strand, 6213424 - 6213463
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6213424 |
gtgaacttagctcaattggtagggatattgcatattatat |
6213463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 211
Target Start/End: Complemental strand, 23933141 - 23933106
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23933141 |
atccccgtgagcttagctcagttggtagggacattg |
23933106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 222
Target Start/End: Original strand, 24253780 - 24253815
Alignment:
| Q |
187 |
cttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24253780 |
cttagctcatttggtagggatattgcatattatatg |
24253815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 219
Target Start/End: Complemental strand, 36314052 - 36314009
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
219 |
Q |
| |
|
|||||| | ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36314052 |
atccccattagcatagctcagttggtagggatattgcatattat |
36314009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 218
Target Start/End: Complemental strand, 42550079 - 42550040
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatatta |
218 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
42550079 |
cccgtgagcttagctcaatcggtagggatattgcatatta |
42550040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 48607822 - 48607775
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||| ||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
48607822 |
atccccgtgagtttaactcagttgatagggatattgcattttatatgt |
48607775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 50746708 - 50746755
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
50746708 |
atccctgtgaccttagctcagttggtagggatatcacatattatatgt |
50746755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 222
Target Start/End: Complemental strand, 50824472 - 50824437
Alignment:
| Q |
187 |
cttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50824472 |
cttagttcagttggtagggatattgcatattatatg |
50824437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 52773322 - 52773369
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||| |||||||||||||| ||||| || |||||||||||||||||| |
|
|
| T |
52773322 |
atcccggtgagcttagctcacttggtgggaatattgcatattatatgt |
52773369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 209
Target Start/End: Original strand, 2876430 - 2876464
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatat |
209 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2876430 |
gatccccgtgagcttagctcaattggtagggatat |
2876464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 17776837 - 17776883
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||| ||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
17776837 |
atccccatgagtttagctcagttggtaggcatattgcattttatatg |
17776883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 19924428 - 19924474
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||| |||| ||||||| |
|
|
| T |
19924428 |
atccccgtgatcttaactcagttggtagggatatcgcattttatatg |
19924474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 215
Target Start/End: Original strand, 29204647 - 29204681
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
29204647 |
cgtgagcttagctcagttggtagggacattgcata |
29204681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 215
Target Start/End: Complemental strand, 30246096 - 30246058
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
30246096 |
tccccgtgagcttagctcatttggtagggacattgcata |
30246058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 210
Target Start/End: Complemental strand, 37626230 - 37626196
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatatt |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37626230 |
atccccgtgagcttacctcagttggtagggatatt |
37626196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 38032201 - 38032247
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||||||||||||| |||| |
|
|
| T |
38032201 |
atccccgtgaacttagatcagctggtagggatattgcatattgtatg |
38032247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 192 - 222
Target Start/End: Original strand, 40634214 - 40634244
Alignment:
| Q |
192 |
ctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40634214 |
ctcagttggtagggatattgcatattatatg |
40634244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 41709992 - 41709950
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| | ||||||| |
|
|
| T |
41709992 |
ccgtgagcttagcttagttggtagggatattgcgtgttatatg |
41709950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 215
Target Start/End: Complemental strand, 41763217 - 41763183
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
41763217 |
cgtgagcttagctcagttggtagggataatgcata |
41763183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 215
Target Start/End: Complemental strand, 47469145 - 47469107
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
47469145 |
tccccgtgagcttagctcagttggcagggacattgcata |
47469107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 221
Target Start/End: Complemental strand, 47643046 - 47643012
Alignment:
| Q |
187 |
cttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
47643046 |
cttagctcagttggtagggatattgcattttatat |
47643012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 221
Target Start/End: Original strand, 51942303 - 51942337
Alignment:
| Q |
187 |
cttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
51942303 |
cttaactcagttggtagggatattgcatattatat |
51942337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 3560449 - 3560408
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
3560449 |
cgtgagcttaactcagttggtagggatattatatattatatg |
3560408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 217
Target Start/End: Complemental strand, 3768035 - 3768006
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3768035 |
ttagctcagttggtagggatattgcatatt |
3768006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 221
Target Start/End: Original strand, 5862973 - 5863014
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
5862973 |
ccgtgagcttaattcagttggtagggatattacatattatat |
5863014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 11081288 - 11081244
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||||||||| |||||||| || |||||||||||||||||| |
|
|
| T |
11081288 |
atccccgtgagcttaactcagttgcta-ggatattgcatattatat |
11081244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 16313774 - 16313733
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||| |||||||| ||||||||||||||||| |
|
|
| T |
16313774 |
cgtgagcttaactcaattggtaggaatattgcatattatatg |
16313733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 209
Target Start/End: Complemental strand, 18893329 - 18893296
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatat |
209 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
18893329 |
atccccgtcagcttagctcagttggtagggatat |
18893296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 20030080 - 20030121
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||| ||||||| |
|
|
| T |
20030080 |
cgtgagcttatctcagttggtaggaatattgcattttatatg |
20030121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 21400085 - 21400044
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
21400085 |
cgtgagcttagctcagttggtagggacaatgcataatatatg |
21400044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 217
Target Start/End: Complemental strand, 26820726 - 26820693
Alignment:
| Q |
184 |
gagcttagctcagttggtagggatattgcatatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
26820726 |
gagcttagctcagttggtagggatattgaatatt |
26820693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 222
Target Start/End: Complemental strand, 32970872 - 32970827
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| ||| ||||||||||| |||||||||||||| ||||||| |
|
|
| T |
32970872 |
tccccgtaagcgtagctcagttgatagggatattgcattttatatg |
32970827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 206
Target Start/End: Original strand, 33200036 - 33200065
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtaggga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33200036 |
tccccgtgagcttagctcagttggtaggga |
33200065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 213
Target Start/End: Original strand, 34180668 - 34180697
Alignment:
| Q |
184 |
gagcttagctcagttggtagggatattgca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34180668 |
gagcttagctcagttggtagggatattgca |
34180697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 37403193 - 37403152
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||||| |
|
|
| T |
37403193 |
cgtgagcttggctcagttagtagggatattgcataatatatg |
37403152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 222
Target Start/End: Complemental strand, 38448932 - 38448887
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| ||| | |||||| |||||| |
|
|
| T |
38448932 |
tccccgtgagcttagctcagttggtaaggacaatgcataatatatg |
38448887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 42469412 - 42469457
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||||| || ||||||||||||| ||||||| ||||||||| |
|
|
| T |
42469412 |
atccccgtgagtttcgctcagttggtagagatattgtatattatat |
42469457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 43677782 - 43677823
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatatt |
217 |
Q |
| |
|
|||||||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
43677782 |
atccccgtcagcttagcccggttggtagggatattgcatatt |
43677823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 222
Target Start/End: Complemental strand, 45140072 - 45140027
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| ||| | |||||| |||||| |
|
|
| T |
45140072 |
tccccgtgagcttagctcagttggtatggacaatgcataatatatg |
45140027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 4865892 - 4865848
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||| |||||| ||||||||||||||| |||||||| ||||||| |
|
|
| T |
4865892 |
cccgttagcttaactcagttggtagggacattgcataatatatgt |
4865848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 222
Target Start/End: Original strand, 8780775 - 8780811
Alignment:
| Q |
186 |
gcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
8780775 |
gcttaactcagttggtacggatattgcatattatatg |
8780811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 9968486 - 9968530
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtaggga-tattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
9968486 |
cccgtgagcttagctcagttggtagggacaaatgcatattatatg |
9968530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 214
Target Start/End: Complemental strand, 12396318 - 12396286
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcat |
214 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
12396318 |
gtgagcttaactcagttggtagggatattgcat |
12396286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 17139579 - 17139539
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| ||||| |
|
|
| T |
17139579 |
cgtgagcttagctcagttggtagggacaatgcataatatat |
17139539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 215
Target Start/End: Original strand, 24874138 - 24874174
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
24874138 |
cccgtgagcttagctcagttgatagggacattgcata |
24874174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 27510941 - 27510985
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||| ||||||| ||||||| ||||||||||||||| |
|
|
| T |
27510941 |
cccgtgagcttaactcagttagtagggactttgcatattatatgt |
27510985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 222
Target Start/End: Complemental strand, 27579545 - 27579501
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| |||| ||||||||||| ||||||| ||||||||||| |
|
|
| T |
27579545 |
ccccgtgaacttaactcagttggtatggatattacatattatatg |
27579501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 215
Target Start/End: Complemental strand, 31401315 - 31401279
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
31401315 |
cccgtgagcttagctcagttgatagggacattgcata |
31401279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 221
Target Start/End: Complemental strand, 31762208 - 31762172
Alignment:
| Q |
185 |
agcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||| |
|
|
| T |
31762208 |
agcttagctcagttggtaagaatattgcatattatat |
31762172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 222
Target Start/End: Complemental strand, 34656470 - 34656422
Alignment:
| Q |
174 |
cgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||| |||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
34656470 |
cgattcccgtgagtttagctcagttgatagagatattgcattttatatg |
34656422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 218
Target Start/End: Complemental strand, 35121116 - 35121080
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatatta |
218 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
35121116 |
gtgagcttagcttagttggtagcgatattgcatatta |
35121080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 182)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 170 - 222
Target Start/End: Original strand, 26022238 - 26022290
Alignment:
| Q |
170 |
gtgtcgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26022238 |
gtgtcaatccccgtgagcttagctcagttggtagggatattgcatattatatg |
26022290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 29716856 - 29716903
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29716856 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
29716903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 32719681 - 32719634
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32719681 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
32719634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 43656033 - 43656080
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43656033 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
43656080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 12298 - 12252
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12298 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
12252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 94584 - 94538
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
94584 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
94538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 1937307 - 1937353
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1937307 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
1937353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 8265265 - 8265311
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8265265 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
8265311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 10736947 - 10736901
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10736947 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
10736901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 11875883 - 11875929
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11875883 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
11875929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 11890890 - 11890936
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11890890 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
11890936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 16449122 - 16449168
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16449122 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
16449168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 17027953 - 17027907
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17027953 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
17027907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 17558389 - 17558343
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17558389 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
17558343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 17698519 - 17698565
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17698519 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
17698565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 30972890 - 30972844
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30972890 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
30972844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 34413059 - 34413105
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34413059 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
34413105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 35939484 - 35939530
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35939484 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
35939530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 39362262 - 39362308
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39362262 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
39362308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 41689879 - 41689925
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41689879 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
41689925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 173 - 222
Target Start/End: Original strand, 133409 - 133458
Alignment:
| Q |
173 |
tcgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
133409 |
tcgatccccgtgagcttagctcagttgatagggatattgcatattatatg |
133458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 177 - 222
Target Start/End: Complemental strand, 23178963 - 23178918
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23178963 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
23178918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 174 - 222
Target Start/End: Complemental strand, 14876677 - 14876629
Alignment:
| Q |
174 |
cgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14876677 |
cgatccccgtgagcttagctcagttggtagggaaattgcatattatatg |
14876629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 174 - 222
Target Start/End: Complemental strand, 38219643 - 38219595
Alignment:
| Q |
174 |
cgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38219643 |
cgatccccgtgagcatagctcagttggtagggatattgcatattatatg |
38219595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 176 - 220
Target Start/End: Complemental strand, 44340418 - 44340374
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattata |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44340418 |
atccccgtgagcttagctcagttggtagggatattgcatattata |
44340374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 34158727 - 34158684
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34158727 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
34158684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 42880945 - 42880992
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42880945 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgt |
42880992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 2787150 - 2787108
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2787150 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
2787108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 2792776 - 2792822
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2792776 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
2792822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 6280477 - 6280523
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6280477 |
atccccgtgagcttagctcagttggtagggatattgaatattatatg |
6280523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 6659286 - 6659332
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6659286 |
atccccgtgagattagctcagttggtagggatattgcatattatatg |
6659332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 6739688 - 6739734
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6739688 |
atccccgtgagattagctcagttggtagggatattgcatattatatg |
6739734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 8034485 - 8034439
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8034485 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
8034439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 181 - 223
Target Start/End: Complemental strand, 8698648 - 8698606
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8698648 |
cgtgagcttagctcagttggtagggatattgcatattatatgt |
8698606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 20540179 - 20540133
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20540179 |
atccccgtgagcttagctcagttgttagggatattgcatattatatg |
20540133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 23858198 - 23858240
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23858198 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
23858240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 26567321 - 26567275
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26567321 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
26567275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 218
Target Start/End: Original strand, 28909462 - 28909504
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatatta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28909462 |
atccccgtgagcttagctcagttggtagggatattgcatatta |
28909504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 29514623 - 29514669
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29514623 |
atccccgtgagcttagctcagttggtagggatattgtatattatatg |
29514669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 33617969 - 33618015
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33617969 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
33618015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 34266009 - 34266055
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34266009 |
atccccgcgagcttagctcagttggtagggatattgcatattatatg |
34266055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 34894366 - 34894412
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34894366 |
atccccgtaagcttagctcagttggtagggatattgcatattatatg |
34894412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 37717360 - 37717406
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37717360 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
37717406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 43284039 - 43283993
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43284039 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
43283993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 38745352 - 38745311
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38745352 |
atccccgtgagcttagctcagttggtagggatattgcatatt |
38745311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 174 - 222
Target Start/End: Complemental strand, 5326245 - 5326197
Alignment:
| Q |
174 |
cgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
5326245 |
cgatccccgtgagcttagctcagttggtagagatattgcattttatatg |
5326197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 27077164 - 27077124
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27077164 |
gtgagcttagctcagttggtagggatattgcatattatatg |
27077124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 42006781 - 42006821
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42006781 |
gtgagcttagctcagttggtagggatattgcatattatatg |
42006821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 2590146 - 2590193
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
2590146 |
atccccgtgagcttagctcaattagtagggatattgcatattatatgt |
2590193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 5328641 - 5328594
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5328641 |
gatccctgtaagcttagctcagttggtagggatattgcatattatatg |
5328594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 10083159 - 10083206
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10083159 |
gatctccgtgagcttaactcagttggtagggatattgcatattatatg |
10083206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 10587347 - 10587304
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10587347 |
cccgtaagcttagctcagttggtagggatattgcatattatatg |
10587304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 34472297 - 34472340
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34472297 |
cccgtgagcttaactcagttggtagggatattgcatattatatg |
34472340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 40362048 - 40362091
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40362048 |
cccgtgagcttagctcagttagtagggatattgcatattatatg |
40362091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 257536 - 257582
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
257536 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatg |
257582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 658384 - 658338
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
658384 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatg |
658338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 844120 - 844074
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
844120 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatg |
844074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 3190022 - 3189976
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
3190022 |
atccccgtgtgcatagctcagttggtagggatattgcatattatatg |
3189976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 7388452 - 7388498
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7388452 |
atccccgtgaacttaactcagttggtagggatattgcatattatatg |
7388498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 7797127 - 7797173
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7797127 |
atccccgtaagcttagctcagttggtagggatattgaatattatatg |
7797173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 7816400 - 7816446
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7816400 |
atccccgtaagcttagctcagttggtagggatattgaatattatatg |
7816446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 9187296 - 9187250
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
9187296 |
atccccgtgagcttagctcagttggtagggatattacattttatatg |
9187250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 10200754 - 10200708
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10200754 |
atcctcgtgagcttagctcagttggtagagatattgcatattatatg |
10200708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 218
Target Start/End: Original strand, 10568082 - 10568124
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatatta |
218 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10568082 |
atccccgtgagtttagctcagttggtagggatattgcatatta |
10568124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 13406601 - 13406643
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13406601 |
ccgtgagcttaactcagttggtagggatattgcatattatatg |
13406643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 16432197 - 16432155
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
16432197 |
ccgtgaacttagctcagttggtagggatattgcatattatatg |
16432155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 17072636 - 17072590
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
17072636 |
atccccgtgagcttagcacagttggtaggtatattgcatattatatg |
17072590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 17575635 - 17575681
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
17575635 |
atccccgtgagcttagcacagttggtaggtatattgcatattatatg |
17575681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 23435306 - 23435260
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23435306 |
atccctgtgagcttagctcagttgatagggatattgcatattatatg |
23435260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 24296937 - 24296895
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24296937 |
ccgtgagcttagctcagttagtagggatattgcatattatatg |
24296895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 24458314 - 24458360
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
24458314 |
atccccgtgagcttagctcagttggaagggatattgtatattatatg |
24458360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 26280857 - 26280811
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
26280857 |
atccccgtgagcttaactcagttggtagggatattgcattttatatg |
26280811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 28420497 - 28420451
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28420497 |
atcctcgtgagcttagctcagttggtaggaatattgcatattatatg |
28420451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 28628662 - 28628708
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
28628662 |
atccccgtgagcttagctcagttggtacggatattacatattatatg |
28628708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 31451026 - 31450984
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31451026 |
ccgtgagcttaactcagttggtagggatattgcatattatatg |
31450984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 36540284 - 36540330
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
36540284 |
atccccgtgagcttaactcagttggtagggatattgcattttatatg |
36540330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 37092088 - 37092134
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
37092088 |
atccccgtgagtttagctcagttggtagggatattgtatattatatg |
37092134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 177 - 219
Target Start/End: Original strand, 38402249 - 38402291
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattat |
219 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38402249 |
tccccgtgagcttaactcagttggtagggatattgcatattat |
38402291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 38620414 - 38620368
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38620414 |
atccctgtgagcttagctcagttggtagggatattgtatattatatg |
38620368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 38955267 - 38955221
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
38955267 |
atccccgtgagcttaactcagttggtagggatattacatattatatg |
38955221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 43186850 - 43186896
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43186850 |
atccgcgtgagtttagctcagttggtagggatattgcatattatatg |
43186896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 182 - 223
Target Start/End: Complemental strand, 197131 - 197090
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
197131 |
gtgagcttagctcagttggtagggatattgcatataatatgt |
197090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 182 - 223
Target Start/End: Complemental strand, 311968 - 311927
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
311968 |
gtgagcttagctcagttggtagggatattgcatataatatgt |
311927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 2168520 - 2168475
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
2168520 |
atccccgtgagcttagctcagttggtagggatattacattttatat |
2168475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 10573103 - 10573144
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10573103 |
cgtgagtttagctcagttggtagggatattgcatattatatg |
10573144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 26192784 - 26192743
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26192784 |
cgtgagcttagttcagttggtagggatattgcatattatatg |
26192743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 29729115 - 29729160
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
29729115 |
atccccgtgagtttagttcagttggtagggatattgcatattatat |
29729160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 38344051 - 38344092
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38344051 |
cgtgagcttaactcagttggtagggatattgcatattatatg |
38344092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 39587544 - 39587589
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
39587544 |
atccccgtgagcttagctcagttggtagagatattgcattttatat |
39587589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 41458297 - 41458338
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41458297 |
cgtgagcttaactcagttggtagggatattgcatattatatg |
41458338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 178 - 222
Target Start/End: Complemental strand, 4615747 - 4615703
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
4615747 |
ccccgtgagtttagttcagttggtagggatattgcatattatatg |
4615703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 8862193 - 8862153
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8862193 |
gtgagcttagctaagttggtagggatattgcatattatatg |
8862153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 11297063 - 11297019
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
11297063 |
cccgtgagcttagttcagttggtagggatattgcattttatatgt |
11297019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 28460203 - 28460243
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28460203 |
cgtgagcttaactcagttggtagggatattgcatattatat |
28460243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 33838324 - 33838368
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33838324 |
cccgtgagtttagctcagttggtagggatattgcaaattatatgt |
33838368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 178 - 222
Target Start/End: Complemental strand, 43856453 - 43856409
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
43856453 |
ccccgtgagcttaactcagttggtagggatattgcattttatatg |
43856409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 182 - 221
Target Start/End: Complemental strand, 3949148 - 3949109
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3949148 |
gtgagcttaactcagttggtagggatattgcatattatat |
3949109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 4654176 - 4654137
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4654176 |
tgagcttagctcagttgctagggatattgcatattatatg |
4654137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 5570894 - 5570937
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
5570894 |
cccgtgagcttagctcagttggttgggatattgcatgttatatg |
5570937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 7194266 - 7194305
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7194266 |
tgagcttagttcagttggtagggatattgcatattatatg |
7194305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 7453349 - 7453396
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
7453349 |
atccccgtgagtttagctcagctggtagggatattgcattttatatgt |
7453396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 7765643 - 7765686
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
7765643 |
cccgtgagcttagctcagttggtatggatattacatattatatg |
7765686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 10030408 - 10030455
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
10030408 |
gatccctgtgagtttagctcagttggtagagatattgcatattatatg |
10030455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 14245143 - 14245190
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||| |||| | ||||||||||||||||||||||||||||| |
|
|
| T |
14245143 |
atccccgtgagtttaggtaagttggtagggatattgcatattatatgt |
14245190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 22274677 - 22274638
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22274677 |
tgagtttagctcagttggtagggatattgcatattatatg |
22274638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 32258007 - 32258050
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
32258007 |
cccgtgagattagctcagttggtagggatattgcatattctatg |
32258050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 211
Target Start/End: Complemental strand, 33604245 - 33604210
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33604245 |
atccccgtgagcttagctcagttggtagggatattg |
33604210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 37090687 - 37090640
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||| |||||||||| |
|
|
| T |
37090687 |
gatccccgtgagtttaactcagttggtagggatattgtatattatatg |
37090640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 177 - 215
Target Start/End: Original strand, 481009 - 481047
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
481009 |
tccccgtgagcttagctcagttggtagggacattgcata |
481047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 222
Target Start/End: Complemental strand, 7764004 - 7763966
Alignment:
| Q |
184 |
gagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7764004 |
gagcttagctcagttggtagagatattgcatattatatg |
7763966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 8953942 - 8953896
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
8953942 |
atcctcgtgagcttaacacagttggtagggatattgcatattatatg |
8953896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 179 - 221
Target Start/End: Complemental strand, 12273747 - 12273705
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
12273747 |
cccgtgagcttagctcagttagtaggaatattgcatattatat |
12273705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 179 - 221
Target Start/End: Complemental strand, 18452355 - 18452313
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
18452355 |
cccgtgagcttagctcagttgttaggaatattgcatattatat |
18452313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 181 - 215
Target Start/End: Complemental strand, 22437858 - 22437824
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
22437858 |
cgtgagcttagctcagttggtagggatattgcata |
22437824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 22487876 - 22487918
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22487876 |
ccgtgagtttagctcagttggtagggatattgcattttatatg |
22487918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 26734069 - 26734115
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26734069 |
atccccgtaagcttagctcagttggtagatatattgcatattatatg |
26734115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 29260616 - 29260662
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
29260616 |
atccacgtgagcttaactcagctggtagggatattgcatattatatg |
29260662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 222
Target Start/End: Complemental strand, 37524272 - 37524234
Alignment:
| Q |
184 |
gagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37524272 |
gagcttagctcagttggtagagatattgcatattatatg |
37524234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 41616439 - 41616393
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||| |||||||||| |
|
|
| T |
41616439 |
atccccgtgagcataactcagttggtagggatattgtatattatatg |
41616393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 43053954 - 43053912
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
43053954 |
ccgtgagcttaactcagttggtagggatatttcatattatatg |
43053912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 43980382 - 43980340
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
43980382 |
ccgtgagcttagttcagttgttagggatattgcatattatatg |
43980340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 223
Target Start/End: Original strand, 36918487 - 36918536
Alignment:
| Q |
174 |
cgatccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||| ||||||||||| ||||||||||| ||||||| |||||||||||| |
|
|
| T |
36918487 |
cgatctccgtgagcttaactcagttggtaaggatattacatattatatgt |
36918536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 179 - 220
Target Start/End: Original strand, 42457133 - 42457174
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattata |
220 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
42457133 |
cccgtgagtttatctcagttggtagggatattgcatattata |
42457174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 1632507 - 1632467
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
1632507 |
gtgagcttagctcagttggtaggaatattacatattatatg |
1632467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 222
Target Start/End: Complemental strand, 7109353 - 7109317
Alignment:
| Q |
186 |
gcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7109353 |
gcttagctcagttggtagagatattgcatattatatg |
7109317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 8969098 - 8969138
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
8969098 |
gtgagcttagctaagttggtaggaatattgcatattatatg |
8969138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 9370161 - 9370211
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttg---gtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9370161 |
gatccccatgagcttagctcagttgttggtagggatattgcatattatatg |
9370211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 178 - 222
Target Start/End: Complemental strand, 10594287 - 10594243
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||| ||||||| |
|
|
| T |
10594287 |
ccccgtgagcttagtttagttggtagggatattgcattttatatg |
10594243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 11127905 - 11127945
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
11127905 |
cgtgaacttagctcagttggtaggaatattgcatattatat |
11127945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 18942918 - 18942958
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
18942918 |
gtgagcttagctcagttggtagggataatgcataatatatg |
18942958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 23339966 - 23339922
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
23339966 |
cccgtgagcttaactcagttggtagagatattgtatattatatgt |
23339922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 29499578 - 29499622
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||| |||||||| |
|
|
| T |
29499578 |
cccgtgaactcagctcagttggtagggatattgcatgttatatgt |
29499622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 37535566 - 37535526
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
37535566 |
gtgagtttagctcaattggtagggatattgcatattatatg |
37535526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 38337097 - 38337053
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38337097 |
cccgtgaatttagttcagttggtagggatattgcatattatatgt |
38337053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 179 - 215
Target Start/End: Original strand, 39974841 - 39974877
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39974841 |
cccgtgagcttagctcagttggtaggaatattgcata |
39974877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 2079745 - 2079698
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||| ||| |||||||| |
|
|
| T |
2079745 |
atccccgtgagcttagctcagttggtagtggtattacattttatatgt |
2079698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 8402406 - 8402363
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||| |||||| |
|
|
| T |
8402406 |
cccgtgagcttagctcaattggtagggacattgcataatatatg |
8402363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 11483120 - 11483163
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| |||||||||| ||||| ||||||||||||||||| |
|
|
| T |
11483120 |
cccgtgagcgtagctcagttagtaggaatattgcatattatatg |
11483163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 13591815 - 13591862
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||| |||| ||||||| |
|
|
| T |
13591815 |
gatccccgtgagtttaactcagttggtagggatatcgcattttatatg |
13591862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 13773465 - 13773418
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||| |||| | ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13773465 |
atcccagtgaacgtagctcagttggtagagatattgcatattatatgt |
13773418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 31712546 - 31712593
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||| |||||||| |||| |||||||||| ||||||||||| |
|
|
| T |
31712546 |
atccccgtgagtttagctcacttggcagggatattgtatattatatgt |
31712593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 37290922 - 37290965
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| || ||||| |||||||||||||||||||||| |
|
|
| T |
37290922 |
cccgtgagcttaacttagttgatagggatattgcatattatatg |
37290965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 40094885 - 40094928
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
40094885 |
cccgtgagcttagctcagttgataaggatattgcattttatatg |
40094928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 40322936 - 40322889
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
40322936 |
atccccgtgagcttggctcagttggtagaaatattgcattttatatgt |
40322889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 40740525 - 40740568
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
40740525 |
cccgtaagcttaactcagttgatagggatattgcatattatatg |
40740568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 43085297 - 43085250
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||| ||||||| |
|
|
| T |
43085297 |
gatccccgtgagcttagctcagttgggagggatatcacattttatatg |
43085250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 44673718 - 44673675
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
44673718 |
cccgtgagcttagctcagttggtagggatatcacattttatatg |
44673675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 222
Target Start/End: Complemental strand, 1286617 - 1286579
Alignment:
| Q |
184 |
gagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
1286617 |
gagcttatctcaattggtagggatattgcatattatatg |
1286579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 1503907 - 1503952
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
1503907 |
atccccatgagcttagctcagttggcagggatattg-atattatatg |
1503952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 2294172 - 2294126
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
2294172 |
atccccgtgagtttagctcaattgatagggatattacatattatatg |
2294126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 3227071 - 3227026
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
3227071 |
atccccgtgagattagttcagttggta-ggatattgcatattatatg |
3227026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 3912237 - 3912191
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||| ||| ||||||||| ||||||||||||||||| |
|
|
| T |
3912237 |
atccccgtgagtttaactcggttggtaggaatattgcatattatatg |
3912191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 215
Target Start/End: Complemental strand, 13059249 - 13059211
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
13059249 |
tccccgtgagcttagctcagttggtagggacaatgcata |
13059211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 222
Target Start/End: Complemental strand, 13647518 - 13647484
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
13647518 |
ttagctcagttggtagagatattgcatattatatg |
13647484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 222
Target Start/End: Complemental strand, 13747943 - 13747909
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
13747943 |
ttagctcagttggtagagatattgcatattatatg |
13747909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 215
Target Start/End: Original strand, 16294218 - 16294256
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
16294218 |
tccccgtgagcttagctcagatggtagggataatgcata |
16294256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 215
Target Start/End: Original strand, 16301920 - 16301958
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
16301920 |
tccccgtgagcttagctcagatggtagggataatgcata |
16301958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 18926208 - 18926162
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||| |||| ||||||| |
|
|
| T |
18926208 |
atccccgtgaccttagctcaattggtagggatatcgcattttatatg |
18926162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 19161964 - 19161923
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19161964 |
ccgtaagcttagctcagttggta-ggatattgcatattatatg |
19161923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 29734078 - 29734032
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||| ||||||||||| |||||||| |||||||||| |
|
|
| T |
29734078 |
atccccgtgagtttaactcagttggtaaggatattgtatattatatg |
29734032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 37838578 - 37838620
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37838578 |
ccgtaagcttagctcaaatggtagggatattgcatattatatg |
37838620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 215
Target Start/End: Original strand, 42877032 - 42877070
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
42877032 |
tccccgtgagcttagctcaattggtagggacattgcata |
42877070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 42877410 - 42877364
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| || ||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
42877410 |
atccccgcgaacttagctcagttggtagagatattgtatattatatg |
42877364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 192 - 222
Target Start/End: Original strand, 44444557 - 44444587
Alignment:
| Q |
192 |
ctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44444557 |
ctcagttggtagggatattgcatattatatg |
44444587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 215
Target Start/End: Original strand, 45105698 - 45105732
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
45105698 |
cgtgagcttagctcagttggtagggataatgcata |
45105732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 222
Target Start/End: Original strand, 5683760 - 5683797
Alignment:
| Q |
185 |
agcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
5683760 |
agcttagctcaattggtaggaatattgcatattatatg |
5683797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 11708985 - 11709026
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
11708985 |
cgtgagcttagctcagttggtagggacaatgcataatatatg |
11709026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 11787148 - 11787193
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||| ||||||| |||||||||| |
|
|
| T |
11787148 |
atccccttgagcttaactcagttggtatggatattacatattatat |
11787193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 222
Target Start/End: Original strand, 19778060 - 19778105
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| ||| | |||||| |||||| |
|
|
| T |
19778060 |
tccccgtgagcttagctcagttggtaaggacaatgcataatatatg |
19778105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 23816789 - 23816830
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||| |||||| |
|
|
| T |
23816789 |
cgtgagcttagctcagttggtaaggataatgcataatatatg |
23816830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 26796960 - 26797001
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||| |||| |
|
|
| T |
26796960 |
cgtgagtttagctcagttggtagggacattgcatattttatg |
26797001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 33451411 - 33451370
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||| |||||| |
|
|
| T |
33451411 |
cgtgagcttagctcagttggtatggataatgcataatatatg |
33451370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 39821883 - 39821924
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
39821883 |
cgtgagcttagctcagttggtagggacaatgcataatatatg |
39821924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 194 - 222
Target Start/End: Original strand, 5038573 - 5038601
Alignment:
| Q |
194 |
cagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5038573 |
cagttggtagggatattgcatattatatg |
5038601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 5332919 - 5332959
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
5332919 |
gtgagcttagctcagttggtagagatattatatattatatg |
5332959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 19163866 - 19163906
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
19163866 |
gtgaacttaactcagttggtagggatattgcatataatatg |
19163906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 20164275 - 20164235
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
20164275 |
gtgagcttaactcagttggtagagatattacatattatatg |
20164235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 212
Target Start/End: Original strand, 39169499 - 39169535
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgc |
212 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
39169499 |
atccccgtgaacttagcttagttggtagggatattgc |
39169535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 41625191 - 41625235
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||| | ||| |||||| ||||||| |
|
|
| T |
41625191 |
cccgtgagcttagctcagttggtatgaataatgcataatatatgt |
41625235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 41865149 - 41865109
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| | |||||| ||||||||||| |
|
|
| T |
41865149 |
gtgagcttagctcagttggtggagatattacatattatatg |
41865109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 223
Target Start/End: Original strand, 43403296 - 43403336
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
43403296 |
tgagcttaattcagttggtagagatattgcatattatatgt |
43403336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 223
Target Start/End: Complemental strand, 44089021 - 44088981
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||| |||||||||||||||| |||||||||| |||||||| |
|
|
| T |
44089021 |
tgagtttagctcagttggtagagatattgcatgttatatgt |
44088981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 4e-19; HSPs: 112)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 174 - 222
Target Start/End: Complemental strand, 9372276 - 9372228
Alignment:
| Q |
174 |
cgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9372276 |
cgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
9372228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 3794247 - 3794200
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3794247 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
3794200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 607184 - 607230
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
607184 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
607230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 4408355 - 4408401
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4408355 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
4408401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 7207841 - 7207887
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7207841 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
7207887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 7545326 - 7545372
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7545326 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
7545372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 7865428 - 7865382
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7865428 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
7865382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 9246455 - 9246409
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9246455 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
9246409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 9435623 - 9435669
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9435623 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
9435669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 10934596 - 10934642
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10934596 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
10934642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 15091445 - 15091491
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15091445 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
15091491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 17441912 - 17441866
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17441912 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
17441866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 19953901 - 19953855
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19953901 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
19953855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 33573814 - 33573860
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33573814 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
33573860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 30885643 - 30885598
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30885643 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
30885598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 8439675 - 8439718
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8439675 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
8439718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 13732808 - 13732855
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13732808 |
gatccccgtgagcttaactcagttggtagggatattgcatattatatg |
13732855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 19892349 - 19892302
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19892349 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgt |
19892302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 29284262 - 29284309
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29284262 |
gatccccgtgagtttagctcagttggtagggatattgcatattatatg |
29284309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 1968993 - 1969039
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1968993 |
atccccgtgagcttagctcagttggtagggatattacatattatatg |
1969039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 3294765 - 3294807
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3294765 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
3294807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 4661093 - 4661139
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4661093 |
atccccgtgagcttagcttagttggtagggatattgcatattatatg |
4661139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 6210051 - 6210097
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6210051 |
atccccgtgaacttagctcagttggtagggatattgcatattatatg |
6210097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 8857087 - 8857133
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8857087 |
atccccgtgagcttagctcagttggtagggatattacatattatatg |
8857133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 9704414 - 9704460
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9704414 |
atccccgtgaacttagctcagttggtagggatattgcatattatatg |
9704460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 27094880 - 27094834
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27094880 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
27094834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 28030861 - 28030907
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28030861 |
atccctgtgagcttagctcagttggtagggatattgcatattatatg |
28030907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 31802050 - 31802096
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31802050 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
31802096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 178 - 222
Target Start/End: Original strand, 2251837 - 2251881
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2251837 |
ccccgtgagcttagctcagttggtagggatattgcatactatatg |
2251881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 4869768 - 4869725
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4869768 |
cccgtgagcttagctcagttggtagggatactgcatattatatg |
4869725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 180 - 223
Target Start/End: Original strand, 22997337 - 22997380
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22997337 |
ccgtgagcttagctcagttggtagggatattgaatattatatgt |
22997380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 180 - 223
Target Start/End: Complemental strand, 23791064 - 23791021
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23791064 |
ccgtgagcttagctcagttggtagggatattgaatattatatgt |
23791021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 30704957 - 30705004
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
30704957 |
atccccgtgagcttagttcagttggtagggatattgcatgttatatgt |
30705004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 32166369 - 32166412
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32166369 |
cccgtgagcttagctcaattggtagggatattgcatattatatg |
32166412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 32611620 - 32611581
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32611620 |
tgagcttagctcagttggtagggatattgcatattatatg |
32611581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 34432867 - 34432824
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34432867 |
cccgtgagcttagttcagttggtagggatattgcatattatatg |
34432824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 978207 - 978161
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
978207 |
atccccgtgagtttagctcagttagtagggatattgcatattatatg |
978161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 179 - 221
Target Start/End: Original strand, 3196619 - 3196661
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3196619 |
cccgtgagcttagctcagttggtagggatattacatattatat |
3196661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 3640511 - 3640557
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3640511 |
atcctcgtgagcttagctcagttggtagggatattgcatagtatatg |
3640557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 7177292 - 7177338
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
7177292 |
atccccgtgagcttagctcagttggtagggatattgtattttatatg |
7177338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 10483609 - 10483563
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10483609 |
atccccgtgatcttagctcagttggtagggatattgcattttatatg |
10483563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 10517196 - 10517242
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
10517196 |
atccccgtgagcttagctcagttggtatggatattgcattttatatg |
10517242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 17454818 - 17454772
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
17454818 |
atccccgtgagcttatctcagttggtagagatattgcatattatatg |
17454772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 19374913 - 19374867
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
19374913 |
atccccgtgagcttagctcagttagtaggaatattgcatattatatg |
19374867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 21248529 - 21248575
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21248529 |
atccccgtaagcttagctcagttggtagggatattgcattttatatg |
21248575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 22574867 - 22574913
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
22574867 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatg |
22574913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 28148806 - 28148760
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28148806 |
atccccttgaacttagctcagttggtagggatattgcatattatatg |
28148760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 28237325 - 28237279
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28237325 |
atcctcgtgagcttaactcagttggtagggatattgcatattatatg |
28237279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 32813723 - 32813677
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
32813723 |
atccccgtgagcttagttcagttggtacggatattgcatattatatg |
32813677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 743565 - 743602
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatatta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
743565 |
cgtgagcttagctcagttggtagggatattgcatatta |
743602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 7414331 - 7414372
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7414331 |
cgtgagcttggctcagttggtagggatattgcatattatatg |
7414372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 361166 - 361206
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
361166 |
gtgagcttaactcagttggtagggatattgcatattatatg |
361206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 27218884 - 27218928
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27218884 |
cccgtgaccttagctcagttgatagggatattgcatattatatgt |
27218928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 31935102 - 31935142
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31935102 |
gtgagcttagctcagttggtagggatattgcattttatatg |
31935142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 180 - 223
Target Start/End: Complemental strand, 2500583 - 2500540
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2500583 |
ccgtgtgcttagcttagttggtagggatattgcatattatatgt |
2500540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 2816886 - 2816933
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
2816886 |
gatccccatgagcttagctcaattggtagggatattgcatgttatatg |
2816933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 15964009 - 15963970
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15964009 |
tgagcttagctcagttggtagggatattgcatattttatg |
15963970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 178 - 221
Target Start/End: Complemental strand, 19618799 - 19618756
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
19618799 |
ccccgtgagtttagctcaattggtagggatattgcatattatat |
19618756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 21203038 - 21203081
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21203038 |
cccgtgagtttagctcagttggtagggatattgcatatcatatg |
21203081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 28222863 - 28222906
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28222863 |
cccgtgaacttaactcagttggtagggatattgcatattatatg |
28222906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 31705896 - 31705943
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
31705896 |
atccccgtgagcttagctcagttggtatggatattgcattatatatgt |
31705943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 32050035 - 32049992
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
32050035 |
cccgtgagcttaactcagctggtagggatattgcatattatatg |
32049992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 216203 - 216249
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
216203 |
atcccagtgagcttagctcaattggtagggatattgcatgttatatg |
216249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 492903 - 492945
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
492903 |
ccgtgagcttagctcagttggcaaggatattgcatattatatg |
492945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 2688653 - 2688607
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||| |||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2688653 |
gatctccgttagcttagctcagttggtaaggatattgcatattatat |
2688607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 222
Target Start/End: Complemental strand, 3795835 - 3795801
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3795835 |
ttagctcagttggtagggatattgcatattatatg |
3795801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 5052146 - 5052100
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||| ||||||| |
|
|
| T |
5052146 |
atccccgtgagcttagctcaattggtagggatatcgcattttatatg |
5052100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 6419155 - 6419109
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||| |||||||||||| |||||||||||||||||| |
|
|
| T |
6419155 |
atccccgtgagtttaactcagttggtagagatattgcatattatatg |
6419109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 7581041 - 7581087
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||| ||||||| |
|
|
| T |
7581041 |
atccccgtgagcttagcttagctggtagggatattgcattttatatg |
7581087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 8297624 - 8297670
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||| ||||||| |
|
|
| T |
8297624 |
atccccgtgagcttagctcaattggtagggatgttgcatgttatatg |
8297670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 10628615 - 10628657
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10628615 |
ccgtgagtttagctcggttggtagggatattgcatattatatg |
10628657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 12284122 - 12284164
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
12284122 |
ccgtgagcttaactcagttggtagggatattgaatattatatg |
12284164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 222
Target Start/End: Complemental strand, 16966455 - 16966421
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
16966455 |
ttagctcagttggtagggatattgcatattatatg |
16966421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 29733625 - 29733671
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
29733625 |
atccccgtgaacttagctcagttggtacggatattacatattatatg |
29733671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 31104879 - 31104925
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||| ||||||||||| |
|
|
| T |
31104879 |
atccccgtgagcttagttcagttgatagggatattacatattatatg |
31104925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 181 - 223
Target Start/End: Original strand, 32837344 - 32837386
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
32837344 |
cgtgagcttagctcagttgctagggatattacatattatatgt |
32837386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 33697186 - 33697140
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
33697186 |
atccccgtgagcttaactcagttgatagggatattgcattttatatg |
33697140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 180 - 221
Target Start/End: Complemental strand, 7328716 - 7328675
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
7328716 |
ccgtgagcttaactcagttggtagggatattgcattttatat |
7328675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 7418280 - 7418321
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
7418280 |
cgtgagcttaactcatttggtagggatattgcatattatatg |
7418321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 222
Target Start/End: Complemental strand, 10501199 - 10501166
Alignment:
| Q |
189 |
tagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10501199 |
tagctcagttggtagggatattgcatattatatg |
10501166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 177 - 222
Target Start/End: Complemental strand, 20568357 - 20568312
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
20568357 |
tccccgtgagcttagctcagttggtaaggacattgcataatatatg |
20568312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 178 - 223
Target Start/End: Original strand, 26347403 - 26347448
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
26347403 |
ccccgtgaacttagctcagttggtagagatattgtatattatatgt |
26347448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 176 - 220
Target Start/End: Complemental strand, 7470802 - 7470758
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattata |
220 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7470802 |
atcctcgtaagcttagctcagttggtagggataatgcatattata |
7470758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 176 - 212
Target Start/End: Complemental strand, 30391293 - 30391257
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgc |
212 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30391293 |
atccccgtgagcttagctcagttgttagggatattgc |
30391257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 1100309 - 1100266
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
1100309 |
cccgtgaacttagctcagttggtagggatatagcattttatatg |
1100266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 3299037 - 3298994
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
3299037 |
cccgtgagcttagatcaattggtagggatattgcatataatatg |
3298994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 7153792 - 7153831
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
7153792 |
tgagcttaactcagttggtagggatattgcatgttatatg |
7153831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 180 - 215
Target Start/End: Complemental strand, 23610388 - 23610353
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23610388 |
ccgtgagcttagctcagttggtagggacattgcata |
23610353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 30700257 - 30700218
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
30700257 |
tgagcttaactcagttggtacggatattgcatattatatg |
30700218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 1435806 - 1435852
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
1435806 |
atcctcgtgagcttaactcagtaggtagggatattacatattatatg |
1435852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 222
Target Start/End: Complemental strand, 4089988 - 4089954
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
4089988 |
ttagctcagtcggtagggatattgcatattatatg |
4089954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 223
Target Start/End: Original strand, 4326213 - 4326259
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||| | ||||||| |||||||||||||| ||||||| |
|
|
| T |
4326213 |
tccccgtgagcttaacccagttggaagggatattgcataatatatgt |
4326259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 223
Target Start/End: Original strand, 9987076 - 9987122
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| | |||||||||||||| |
|
|
| T |
9987076 |
tccccgtgagcttaactcagttggtaaggacaatgcatattatatgt |
9987122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 222
Target Start/End: Complemental strand, 13158770 - 13158736
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
13158770 |
ttagctaagttggtagggatattgcatattatatg |
13158736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 222
Target Start/End: Complemental strand, 13163626 - 13163592
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
13163626 |
ttagctaagttggtagggatattgcatattatatg |
13163592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 14579359 - 14579313
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||||| | ||||||||||||||||| |||||||| |
|
|
| T |
14579359 |
atccccgtgagtttagcttatttggtagggatattgcaaattatatg |
14579313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 24758736 - 24758782
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||| |||| ||||||| |
|
|
| T |
24758736 |
atccccgtgagcttaactcaattggtagggatatcgcattttatatg |
24758782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 215
Target Start/End: Original strand, 28021226 - 28021264
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
28021226 |
tccccgtgagtttagctcagttggtagggacattgcata |
28021264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 215
Target Start/End: Original strand, 34268280 - 34268318
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
34268280 |
tccccgtgagcttagctccgttggtagggacattgcata |
34268318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 2426066 - 2426107
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
2426066 |
cgtgaacttagctcagttggtaggaatattacatattatatg |
2426107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 222
Target Start/End: Complemental strand, 6658643 - 6658598
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||| |||| ||||||| |||||||| |||||| |
|
|
| T |
6658643 |
tccccgtgagcttagcttagttagtagggaaattgcataatatatg |
6658598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 10780169 - 10780128
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
10780169 |
cgtgagcttagctcagttggtagggacaatgcataatatatg |
10780128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 222
Target Start/End: Complemental strand, 15869169 - 15869124
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||| || || ||||||| ||||||| |
|
|
| T |
15869169 |
tccccgtgagcttagctcagttggcagtgacattgcattttatatg |
15869124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 20584070 - 20584115
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||| ||||||||| |||||||| ||| ||||||||||||||||| |
|
|
| T |
20584070 |
atccctgtgagcttaactcagttgatagcgatattgcatattatat |
20584115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 30938390 - 30938431
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
30938390 |
cgtgagcttaactcagttggtagggacattgcataatatatg |
30938431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 217
Target Start/End: Complemental strand, 31803657 - 31803628
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31803657 |
ttagctcagttggtagggatattgcatatt |
31803628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 216
Target Start/End: Complemental strand, 31956236 - 31956203
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatat |
216 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
31956236 |
tgagcttagctcagttggtagggatatcgcatat |
31956203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 193 - 222
Target Start/End: Complemental strand, 32412369 - 32412340
Alignment:
| Q |
193 |
tcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32412369 |
tcagttggtagggatattgcatattatatg |
32412340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 222
Target Start/End: Original strand, 7072085 - 7072121
Alignment:
| Q |
186 |
gcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
7072085 |
gcttaactcagttggtagggatattacatattatatg |
7072121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 223
Target Start/End: Complemental strand, 14709086 - 14709046
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||| ||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
14709086 |
tgagcctagttcagttggtagagatattgcatattatatgt |
14709046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 15285546 - 15285586
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
15285546 |
gtgagtttaactcagttggtagggatattacatattatatg |
15285586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 223
Target Start/End: Original strand, 34040681 - 34040717
Alignment:
| Q |
187 |
cttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
34040681 |
cttagctcagttgatagggatattgtatattatatgt |
34040717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 180)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 175 - 223
Target Start/End: Original strand, 53163590 - 53163638
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53163590 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatgt |
53163638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 39966148 - 39966101
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39966148 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
39966101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 882386 - 882432
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
882386 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
882432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 2522923 - 2522969
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2522923 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
2522969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 7269952 - 7269998
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7269952 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
7269998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 7920317 - 7920363
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7920317 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
7920363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 19550503 - 19550549
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19550503 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
19550549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 19999864 - 19999910
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19999864 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
19999910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 22502004 - 22501958
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22502004 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
22501958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 28550392 - 28550346
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28550392 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
28550346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 31327574 - 31327528
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31327574 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
31327528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 31327791 - 31327745
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31327791 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
31327745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 37800684 - 37800638
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37800684 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
37800638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 40192153 - 40192199
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40192153 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
40192199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 40548300 - 40548346
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40548300 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
40548346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 40933904 - 40933858
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40933904 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
40933858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 44652055 - 44652009
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44652055 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
44652009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 45701341 - 45701387
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45701341 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
45701387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 50496887 - 50496841
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50496887 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
50496841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 52410314 - 52410268
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52410314 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
52410268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 52945892 - 52945938
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52945892 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
52945938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 53347363 - 53347317
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53347363 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
53347317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 178 - 222
Target Start/End: Complemental strand, 6920034 - 6919990
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6920034 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
6919990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 175 - 223
Target Start/End: Original strand, 11820000 - 11820048
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11820000 |
gatccccgtgagcttagctcagttggtagggatattgcatgttatatgt |
11820048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 4139000 - 4139043
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4139000 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
4139043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 9176656 - 9176613
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9176656 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
9176613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 47098732 - 47098775
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47098732 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
47098775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 3748675 - 3748629
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3748675 |
atccccgtgagcttagctcagttggtagggatattgtatattatatg |
3748629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 10176976 - 10176930
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10176976 |
atccccgtgaggttagctcagttggtagggatattgcatattatatg |
10176930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 10482926 - 10482880
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10482926 |
atccccgtgaacttagctcagttggtagggatattgcatattatatg |
10482880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 15975149 - 15975195
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15975149 |
atccctgtgagcttagctcagttggtagggatattgcatattatatg |
15975195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 17218485 - 17218531
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17218485 |
atccccatgagcttagctcagttggtagggatattgcatattatatg |
17218531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 181 - 223
Target Start/End: Complemental strand, 17602744 - 17602702
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17602744 |
cgtgagcttagctcagttggtagggatattgcatattatatgt |
17602702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 18194335 - 18194381
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18194335 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
18194381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 19996525 - 19996479
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19996525 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
19996479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 25939003 - 25938957
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25939003 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
25938957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 28689745 - 28689699
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28689745 |
atccccgtgaacttagctcagttggtagggatattgcatattatatg |
28689699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 218
Target Start/End: Complemental strand, 30555300 - 30555258
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatatta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30555300 |
atccccgtgagcttagctcagttggtagggatattgcatatta |
30555258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 30779640 - 30779594
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30779640 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatg |
30779594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 31529031 - 31528985
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31529031 |
atccccgtgagcttagctcagttggtagggatattgaatattatatg |
31528985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 31586944 - 31586990
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31586944 |
atccccatgagcttagctcagttggtagggatattgcatattatatg |
31586990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 32256627 - 32256581
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32256627 |
atccccgtgagcttagctcagttggtagggatattgcatgttatatg |
32256581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 34102684 - 34102638
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34102684 |
atccccgtgagcttagttcagttggtagggatattgcatattatatg |
34102638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 34898840 - 34898794
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34898840 |
atccccgtgagcttagttcagttggtagggatattgcatattatatg |
34898794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 41936480 - 41936434
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41936480 |
atccccgtaagcttagctcagttggtagggatattgcatattatatg |
41936434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 46796002 - 46795956
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46796002 |
atccccgtgagcttagctcagttggtagggatattgcattttatatg |
46795956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 48739817 - 48739771
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48739817 |
atccccgtgagcttagctcagttggtagggatattgcattttatatg |
48739771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 50536905 - 50536859
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
50536905 |
atccccgtgagcttagctcagttggtagagatattgcatattatatg |
50536859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 52974126 - 52974080
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52974126 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
52974080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 8125641 - 8125682
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8125641 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
8125682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 5636866 - 5636826
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5636866 |
gtgagcttagctcagttggtagggatattgcatattatatg |
5636826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 48546173 - 48546217
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48546173 |
cccgtgagcttagctcagttggtagtgatattgcatattatatgt |
48546217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 178 - 222
Target Start/End: Original strand, 50234123 - 50234167
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50234123 |
ccccgtgagcttacctcagttggtagggatattgcatattatatg |
50234167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 52670223 - 52670179
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52670223 |
cccgtgagcttagttcagttggtagggatattgcatattatatgt |
52670179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 13638318 - 13638271
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
13638318 |
atccccgtgagcttagttcagttggtagggatattacatattatatgt |
13638271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 22472388 - 22472341
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
22472388 |
gatccccgtgagcttaactcagttggtagagatattgcatattatatg |
22472341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 26942753 - 26942796
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26942753 |
cccgtaagcttagctcagttggtagggatattgcatattatatg |
26942796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 32828441 - 32828484
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32828441 |
cccgtgagcttagctcggttggtagggatattgcatattatatg |
32828484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 33706801 - 33706754
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
33706801 |
gatccccgtgagcttagctcaattggtagggatattacatattatatg |
33706754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 36625237 - 36625198
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36625237 |
tgagcttagctcagttggtagggatattgcatattatatg |
36625198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 37488534 - 37488487
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
37488534 |
gatccccgtgagcttagctcagttggtagggatatcgcattttatatg |
37488487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 39719935 - 39719978
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39719935 |
cccgtgagtttagctcagttggtagggatattgcatattatatg |
39719978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 45551882 - 45551835
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
45551882 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgt |
45551835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 49447134 - 49447181
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49447134 |
gatccccgtgagtatagctcagttggtagggatattgcatattatatg |
49447181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 2368933 - 2368979
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2368933 |
atcctcgtgagcttagctcagttgttagggatattgcatattatatg |
2368979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 6488121 - 6488167
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6488121 |
atccccatgagcttagctcaattggtagggatattgcatattatatg |
6488167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 8964849 - 8964803
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8964849 |
atccccgtgagtttagctcagttggtagggatattgcatatcatatg |
8964803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 17608392 - 17608346
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
17608392 |
atccccgtgagcttaacttagttggtagggatattgcatattatatg |
17608346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 32144581 - 32144627
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
32144581 |
atccccgtgagcttagcttagttggtaggggtattgcatattatatg |
32144627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 33225421 - 33225375
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
33225421 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatg |
33225375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 34847540 - 34847586
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34847540 |
atccccgtgagcttaattcagttggtagggatattgcatattatatg |
34847586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 44364018 - 44364064
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44364018 |
atccccgtgagtttaactcagttggtagggatattgcatattatatg |
44364064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 45871014 - 45871060
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
45871014 |
atccccgtgagtttagctcagttggtagggatattgtatattatatg |
45871060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 48251569 - 48251615
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48251569 |
atccctgtgagcttagctcagttgatagggatattgcatattatatg |
48251615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 49408772 - 49408818
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
49408772 |
atccccgtgagcttagctcagctggtagggatatcgcatattatatg |
49408818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 179 - 221
Target Start/End: Complemental strand, 52046455 - 52046413
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52046455 |
cccgtgagcttagctcagttggtagggatattgcattttatat |
52046413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 53752773 - 53752727
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
53752773 |
atccccgtgagcttaactcagttggtagggatatggcatattatatg |
53752727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 54769899 - 54769857
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
54769899 |
ccgtgagcttagcttagttggtagggatattgcatattatatg |
54769857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 222
Target Start/End: Complemental strand, 4640544 - 4640507
Alignment:
| Q |
185 |
agcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4640544 |
agcttagctcagttggtagggatattgcatattatatg |
4640507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 11250659 - 11250618
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11250659 |
cgtgaacttagctcagttggtagggatattgcatattatatg |
11250618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 31316631 - 31316676
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
31316631 |
atccccgtgagcttagctcagttgatagggatattgtatattatat |
31316676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 179 - 216
Target Start/End: Original strand, 34757529 - 34757566
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34757529 |
cccgtgagcttagctcagttggtagggatattgcatat |
34757566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 44685241 - 44685196
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
44685241 |
atccccgtgagcttagcttagttggtagagatattgcatattatat |
44685196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 49750474 - 49750433
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49750474 |
cgtgagcttagctcagttgatagggatattgcatattatatg |
49750433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 175 - 223
Target Start/End: Complemental strand, 1743871 - 1743823
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| |||||||| |
|
|
| T |
1743871 |
gatccccgtgagcttaactcaattggtagggatattgcattttatatgt |
1743823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 174 - 222
Target Start/End: Complemental strand, 2390429 - 2390381
Alignment:
| Q |
174 |
cgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
2390429 |
cgatccccgtaagcgtagctcagttgatagggatattgcatattatatg |
2390381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 10349402 - 10349442
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatat |
216 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10349402 |
atccccgtgagcttagctcagttgatagggatattgcatat |
10349442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 12894600 - 12894556
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
12894600 |
cccgtgagcttaactcagttggtagggatattgcattttatatgt |
12894556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 183 - 223
Target Start/End: Complemental strand, 29559740 - 29559700
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29559740 |
tgagcttaactcagttggtagggatattgcatattatatgt |
29559700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 176 - 220
Target Start/End: Original strand, 39300381 - 39300425
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattata |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
39300381 |
atccccgtgagcttagctcagttggtagggatattacattttata |
39300425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 178 - 222
Target Start/End: Complemental strand, 52309181 - 52309137
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
52309181 |
ccccgtgagcttaactcagttggtagggatattgcatactatatg |
52309137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 52984013 - 52984053
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52984013 |
gtgagcttagctcagttggtagggatattgcatattgtatg |
52984053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 53577958 - 53577998
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53577958 |
gtgagcttagctcagttggtagggatgttgcatattatatg |
53577998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 54021401 - 54021361
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
54021401 |
gtgagcttagctcagttggtatggatattgcatattatatg |
54021361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 3894544 - 3894587
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
3894544 |
cccgtgagcttagttcagttggtatggatattgcatattatatg |
3894587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 4541898 - 4541941
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
4541898 |
cccgtgagcttagttcagttggtagggatattgtatattatatg |
4541941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 4860161 - 4860204
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
4860161 |
cccgtgagcttagctcagttggtacggatattgcattttatatg |
4860204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 4880169 - 4880212
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
4880169 |
cccgtgagcttagctcagttggtacggatattgcattttatatg |
4880212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 218
Target Start/End: Complemental strand, 5326106 - 5326067
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatatta |
218 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5326106 |
cccgtgagcttagctcagttggtagcgatattgcatatta |
5326067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 11436500 - 11436547
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11436500 |
gatcctcgtgaacttaactcagttggtagggatattgcatattatatg |
11436547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 20489819 - 20489858
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20489819 |
tgagcttagctcagttggtagggttattgcatattatatg |
20489858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 24430146 - 24430189
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
24430146 |
cccgtgagcttagctcagttggtagagatattgtatattatatg |
24430189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 25279132 - 25279085
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
25279132 |
atcctcgtgagcttagcttagttggtagggatattgtatattatatgt |
25279085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 29373519 - 29373476
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
29373519 |
cccgtgagcttaactcagttggtaaggatattgcatattatatg |
29373476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 180 - 223
Target Start/End: Original strand, 45198724 - 45198767
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45198724 |
ccgttagcttagttcagttggtagggatattgcatattatatgt |
45198767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 8762153 - 8762107
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| || |||||||||||||||| ||||||||||| |
|
|
| T |
8762153 |
atccccgtgagcttaacttagttggtagggatattacatattatatg |
8762107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 28193795 - 28193841
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
28193795 |
atccccttgagcttaactcagttggtagggatattgcattttatatg |
28193841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 40723733 - 40723687
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
40723733 |
atccccgagagcttaactcagttggtagggatattgcatgttatatg |
40723687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 222
Target Start/End: Complemental strand, 42108243 - 42108209
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42108243 |
ttagctcagttggtagggatattgcatattatatg |
42108209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 53432810 - 53432764
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
53432810 |
atccctgtgagtttaactcagttggtagggatattgcatattatatg |
53432764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 16895303 - 16895258
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||| ||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
16895303 |
atccccgagagcttaactcagttggtaggaatattgcatattatat |
16895258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 34740289 - 34740330
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34740289 |
cgtgagtttagcccagttggtagggatattgcatattatatg |
34740330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 177 - 222
Target Start/End: Original strand, 36763427 - 36763472
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
36763427 |
tccccgtgagcttggctcagttggtagggacattgcataatatatg |
36763472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 45513068 - 45513023
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
45513068 |
atccccgtaagcttagctcagttagtatggatattgcatattatat |
45513023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 46879999 - 46880040
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
46879999 |
cgtgagcttagctcagttgatagggatattgcattttatatg |
46880040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 180 - 221
Target Start/End: Complemental strand, 50675811 - 50675770
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
50675811 |
ccgtgagtttatctcagttggtagggatattgcatattatat |
50675770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 177 - 222
Target Start/End: Original strand, 52575461 - 52575506
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||| ||||||| |
|
|
| T |
52575461 |
tccccgtgagcttagctcagttggtacgaatattgcattttatatg |
52575506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 552174 - 552214
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
552174 |
gtgagcttaactcagttggtagggatattgcataatatatg |
552214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 4200652 - 4200612
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4200652 |
gtgaacttaactcagttggtagggatattgcatattatatg |
4200612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 25488885 - 25488929
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||| |
|
|
| T |
25488885 |
cccgtgagcttaactcagttgttagggatattacatattatatgt |
25488929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 183 - 223
Target Start/End: Complemental strand, 51155158 - 51155118
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
51155158 |
tgagcttagctcagttggtaggaatattggatattatatgt |
51155118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 51772892 - 51772932
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
51772892 |
gtgagcttaacttagttggtagggatattgcatattatatg |
51772932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 217
Target Start/End: Original strand, 16886585 - 16886620
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatatt |
217 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16886585 |
gtgagcttagctcagttggtagggacattgcatatt |
16886620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 19591652 - 19591605
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||| ||||||||||||||||| || | |||||||||||||||||| |
|
|
| T |
19591652 |
atccccttgagcttagctcagttgataagtatattgcatattatatgt |
19591605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 180 - 215
Target Start/End: Complemental strand, 20887838 - 20887803
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20887838 |
ccgtgagtttagctcagttggtagggatattgcata |
20887803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 21405160 - 21405207
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||| | |||||| |
|
|
| T |
21405160 |
atccccgtgagcttacctcagttggaagggatattgcatttaatatgt |
21405207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 25833819 - 25833866
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25833819 |
gatctccgttagcttagctcagttggtaaagatattgcatattatatg |
25833866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 28396848 - 28396809
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
28396848 |
tgagcttaactcagttggtagggatattgcatgttatatg |
28396809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 33607009 - 33606966
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
33607009 |
cccgtgaacttagctcaattggtagggatattgcattttatatg |
33606966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 37112814 - 37112853
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
37112814 |
tgagcttagctcagttggtaaggatattgcattttatatg |
37112853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 51467172 - 51467219
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||| |||| ||||||| |
|
|
| T |
51467172 |
gatccccgtgaacttagctcagttgatagggatatcgcattttatatg |
51467219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 2007156 - 2007110
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||| |||||||||||| ||||||||||||||||| |
|
|
| T |
2007156 |
atccccgtgaacttaactcagttggtagaaatattgcatattatatg |
2007110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 215
Target Start/End: Complemental strand, 4237051 - 4237013
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
4237051 |
tccccgtgagcttagttcagttggtagggacattgcata |
4237013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 11234439 - 11234485
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||| || ||||||| |
|
|
| T |
11234439 |
atccccgtgagcttagctcagttagtagagatattgtattttatatg |
11234485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 15299073 - 15299115
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| |||| ||||||||||||||||||| |||||||||| |
|
|
| T |
15299073 |
ccgtgagtttagttcagttggtagggatattgtatattatatg |
15299115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 15492088 - 15492134
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||| || |||||||||||||||||||| ||||||| |
|
|
| T |
15492088 |
atccccatgagcttaactgagttggtagggatattgcattttatatg |
15492134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 215
Target Start/End: Original strand, 24303388 - 24303426
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
24303388 |
tccccgtgagcttagctcagttggcagggacattgcata |
24303426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 29098689 - 29098735
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||| |||||||||||| ||||||| |||||||||| |
|
|
| T |
29098689 |
atccccgtgaacttaactcagttggtagagatattgtatattatatg |
29098735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 29496172 - 29496134
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
29496172 |
tgagtttaactcagttggtagggatattgcatattatat |
29496134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 31922353 - 31922399
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
31922353 |
atccccgtgagcttgtctcagttggtaagaatattgcatattatatg |
31922399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 36666458 - 36666504
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||| |||||||||| |
|
|
| T |
36666458 |
atccccgtgagcttagttcagttggcaggaatattgtatattatatg |
36666504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 38819396 - 38819350
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||| ||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
38819396 |
atccccatgaacttagcttagttggtagggatatttcatattatatg |
38819350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 40963784 - 40963738
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||||||| || ||||||||||| ||||||| |
|
|
| T |
40963784 |
atccccgtgagcttaactcagttgataaggatattgcattttatatg |
40963738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 215
Target Start/End: Original strand, 44764724 - 44764758
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
44764724 |
cgtgagcttagctcagttggtagggacattgcata |
44764758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 44945730 - 44945688
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| ||||||||| |
|
|
| T |
44945730 |
ccgtgagcttatctcagttggtaggaatattgcgtattatatg |
44945688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 46730842 - 46730800
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| |||| |||| |||||||||||| |
|
|
| T |
46730842 |
ccgtgagcttagctcagttgataggcatatagcatattatatg |
46730800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 50727317 - 50727271
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| || |||||||||||||||||| |||| ||||||| |
|
|
| T |
50727317 |
atccccgtgagcctaactcagttggtagggatatcgcattttatatg |
50727271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 50785531 - 50785577
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| || |||||||||||||||||| |||| ||||||| |
|
|
| T |
50785531 |
atccccgtgagcctaactcagttggtagggatatcgcattttatatg |
50785577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 51425837 - 51425883
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||| ||||||| |
|
|
| T |
51425837 |
atccccgtgagcttaactcagttggtagggatatcacattttatatg |
51425883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 215
Target Start/End: Original strand, 53203822 - 53203860
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
53203822 |
tccccgtaagattagctcagttggtagggatattgcata |
53203860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 217
Target Start/End: Complemental strand, 1697917 - 1697880
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatatt |
217 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
1697917 |
ccgtgagcttaactcagttagtagggatattgcatatt |
1697880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 223
Target Start/End: Complemental strand, 7938363 - 7938322
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||| |||||||| |
|
|
| T |
7938363 |
gtgagcttaactcagttggtagggatattacattttatatgt |
7938322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 7974574 - 7974533
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||| |||||| |
|
|
| T |
7974574 |
cgtgagcttagctcagttggtatggataatgcataatatatg |
7974533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 8756526 - 8756567
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||| ||||||| |
|
|
| T |
8756526 |
cgtgagcttaactcagttggtaggaatattgcattttatatg |
8756567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 222
Target Start/End: Original strand, 14795109 - 14795154
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||| ||||||||| || |||||||| |||||| |
|
|
| T |
14795109 |
tccccgtgagcttagcttagttggtagtgacattgcataatatatg |
14795154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 179 - 208
Target Start/End: Complemental strand, 15975449 - 15975420
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggata |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15975449 |
cccgtgagcttagctcagttggtagggata |
15975420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 17765579 - 17765620
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
17765579 |
cgtgagcttagcccggttggtagggatattgtatattatatg |
17765620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 18870787 - 18870746
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
18870787 |
cgtgagcttagctcagttggtagggacaatgcataatatatg |
18870746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 19066899 - 19066940
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
19066899 |
cgtgagcttagcccggttggtagggatattgtatattatatg |
19066940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 178 - 223
Target Start/End: Original strand, 19866473 - 19866517
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||| |||||||| |
|
|
| T |
19866473 |
ccccgtgagcttagctcag-tgatagggatattgcattttatatgt |
19866517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 215
Target Start/End: Original strand, 32776214 - 32776247
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
32776214 |
gtgagcttagctcagttggtagggacattgcata |
32776247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 193 - 222
Target Start/End: Original strand, 42268798 - 42268827
Alignment:
| Q |
193 |
tcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42268798 |
tcagttggtagggatattgcatattatatg |
42268827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 214
Target Start/End: Original strand, 45118638 - 45118675
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcat |
214 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
45118638 |
tccccatgagcttagctcagttggtagggacattgcat |
45118675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 48315086 - 48315045
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||| |||||| |
|
|
| T |
48315086 |
cgtgagcttagctcagttggtaaggataatgcataatatatg |
48315045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 221
Target Start/End: Complemental strand, 52434728 - 52434695
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
52434728 |
ttagttcagttggtagggatattgcatattatat |
52434695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 221
Target Start/End: Complemental strand, 7617741 - 7617705
Alignment:
| Q |
185 |
agcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
7617741 |
agcttaactcagttggtagggatattgcataatatat |
7617705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 219
Target Start/End: Complemental strand, 16906903 - 16906867
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattat |
219 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
16906903 |
tgagcttggctcagttgctagggatattgcatattat |
16906867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 221
Target Start/End: Complemental strand, 18754666 - 18754630
Alignment:
| Q |
185 |
agcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
18754666 |
agcttagctcagttggtaaggatgttgcatattatat |
18754630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 222
Target Start/End: Original strand, 22857401 - 22857437
Alignment:
| Q |
186 |
gcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
22857401 |
gcttaactcagttggtaggaatattgcatattatatg |
22857437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 25638459 - 25638415
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||| |||| |||| ||||||| ||||||||||||||||||| |
|
|
| T |
25638459 |
cccgtgaacttaactcaattggtagagatattgcatattatatgt |
25638415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 27983858 - 27983898
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
27983858 |
gtgagcttagctcagttggtagaaatattgcattttatatg |
27983898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 31673316 - 31673276
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
31673316 |
gtgagcttgtctcagttggtaaggatattgcatattatatg |
31673276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 34579520 - 34579476
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| || |||||||| |
|
|
| T |
34579520 |
cccgtgagcttaactcagttgatagggatattgaattttatatgt |
34579476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 223
Target Start/End: Complemental strand, 35718618 - 35718582
Alignment:
| Q |
187 |
cttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
35718618 |
cttagctcagttggtagggacattgcataatatatgt |
35718582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 36834772 - 36834732
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| || ||||||||||| |||||||||| |
|
|
| T |
36834772 |
gtgagcttagctcagctgatagggatattgtatattatatg |
36834732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 222
Target Start/End: Complemental strand, 40910246 - 40910207
Alignment:
| Q |
185 |
agcttagctcagttggta--gggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40910246 |
agcttagctcagttggtagggggatattgcatattatatg |
40910207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 220
Target Start/End: Original strand, 43645076 - 43645116
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattata |
220 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
43645076 |
ccgtgagcttagctcagttgacagggatatttcatattata |
43645116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 222
Target Start/End: Original strand, 44106609 - 44106645
Alignment:
| Q |
186 |
gcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
44106609 |
gcttaactcagttgctagggatattgcatattatatg |
44106645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 208
Target Start/End: Complemental strand, 46336572 - 46336544
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggata |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46336572 |
ccgtgagcttagctcagttggtagggata |
46336544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 55066661 - 55066621
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||| |||||| |
|
|
| T |
55066661 |
gtgagcttagctcagttggtacggataatgcataatatatg |
55066621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 17616 - 17663
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17616 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
17663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 1e-18; HSPs: 148)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 9835029 - 9835076
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9835029 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
9835076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 12891554 - 12891601
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12891554 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
12891601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 21918048 - 21918095
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21918048 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
21918095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 1743124 - 1743170
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1743124 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
1743170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 4417758 - 4417712
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4417758 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
4417712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 6518849 - 6518803
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6518849 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
6518803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 11897245 - 11897291
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11897245 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
11897291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 12463753 - 12463799
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12463753 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
12463799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 16603395 - 16603441
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16603395 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
16603441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 17545245 - 17545199
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17545245 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
17545199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 27765254 - 27765300
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27765254 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
27765300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 32505685 - 32505731
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32505685 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
32505731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 41179876 - 41179830
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41179876 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
41179830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 42320314 - 42320360
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42320314 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
42320360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 169 - 222
Target Start/End: Original strand, 35515502 - 35515555
Alignment:
| Q |
169 |
agtgtcgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35515502 |
agtgttgattcccgtgagcttagctcagttggtagggatattgcatattatatg |
35515555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 178 - 222
Target Start/End: Complemental strand, 4745947 - 4745903
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4745947 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
4745903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 178 - 222
Target Start/End: Complemental strand, 25472654 - 25472610
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25472654 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
25472610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 12767960 - 12768007
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12767960 |
gatccccgtgagcttagttcagttggtagggatattgcatattatatg |
12768007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 29713450 - 29713403
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29713450 |
gatccccgtgagcttagctcagttggtagggatattgcctattatatg |
29713403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 39886285 - 39886238
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39886285 |
atccccgtgagcatagctcagttggtagggatattgcatattatatgt |
39886238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 40091473 - 40091520
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40091473 |
gatccccgtgagcttaactcagttggtagggatattgcatattatatg |
40091520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 2328589 - 2328635
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2328589 |
atccccgtgagcttagcttagttggtagggatattgcatattatatg |
2328635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 2848210 - 2848256
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2848210 |
atccccgtgagcttagctcagttggtagggatattgtatattatatg |
2848256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 5900289 - 5900335
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5900289 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
5900335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 5966826 - 5966872
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5966826 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
5966872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 6558798 - 6558844
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6558798 |
atccccgtgagcttagctcaattggtagggatattgcatattatatg |
6558844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 8241047 - 8241093
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8241047 |
atccccatgagcttagctcagttggtagggatattgcatattatatg |
8241093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 8968750 - 8968792
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8968750 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
8968792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 9125660 - 9125706
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9125660 |
atccccgtgagcttagctcagttggtagcgatattgcatattatatg |
9125706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 13622019 - 13621973
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13622019 |
atccccgtgagcttagctcagttggtagggatatcgcatattatatg |
13621973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 18815345 - 18815391
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18815345 |
atccccgtgagcttagctcagttggtaaggatattgcatattatatg |
18815391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 21749450 - 21749404
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21749450 |
atccccgtgagcttagctcagttggtagggatactgcatattatatg |
21749404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 218
Target Start/End: Complemental strand, 25648158 - 25648116
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatatta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25648158 |
atccccgtgagcttagctcagttggtagggatattgcatatta |
25648116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 32706319 - 32706365
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32706319 |
atccccgtgagcttagctcagttggtagggatattacatattatatg |
32706365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 36888468 - 36888422
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36888468 |
atccccgtgagcttagttcagttggtagggatattgcatattatatg |
36888422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 39919166 - 39919120
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39919166 |
atccccgtgagcttagcttagttggtagggatattgcatattatatg |
39919120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 42525397 - 42525443
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42525397 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
42525443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 831588 - 831635
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
831588 |
gatccccgtgagcttagctctgttggtagggatatttcatattatatg |
831635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 10241721 - 10241768
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10241721 |
gatctccgtgagcttaactcagttggtagggatattgcatattatatg |
10241768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 16386807 - 16386768
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16386807 |
tgagcttagctcagttggtagggatattgcatattatatg |
16386768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 17666006 - 17666049
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17666006 |
cccgtgagcttagctcagttggtaggaatattgcatattatatg |
17666049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 23292487 - 23292444
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23292487 |
cccgtgagcttagctcagttggtagggatattgcatgttatatg |
23292444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 26912830 - 26912877
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
26912830 |
atccccgtgagcttaactcaattggtagggatattgcatattatatgt |
26912877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 43580878 - 43580921
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43580878 |
cccgtgaacttagctcagttggtagggatattgcatattatatg |
43580921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 546803 - 546845
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
546803 |
ccgtgagcttaactcagttggtagggatattgcatattatatg |
546845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 1269240 - 1269194
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
1269240 |
atccccgtgagcttagctcaattggtagagatattgcatattatatg |
1269194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 8478966 - 8478920
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
8478966 |
atccccgtgagtttagttcagttggtagggatattgcatattatatg |
8478920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 11774532 - 11774486
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11774532 |
atccccgtgaccttagctcagtttgtagggatattgcatattatatg |
11774486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 15241393 - 15241439
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
15241393 |
atccccgtgagcttagctcagttgataggaatattgcatattatatg |
15241439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 24033074 - 24033120
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24033074 |
atccccgcgagcttagctcagttggtagggatattgcattttatatg |
24033120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 25729513 - 25729467
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
25729513 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatg |
25729467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 27798618 - 27798664
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27798618 |
atccctgtgagcatagctcagttggtagggatattgcatattatatg |
27798664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 33736087 - 33736041
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33736087 |
atccccgggagcttaactcagttggtagggatattgcatattatatg |
33736041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 40361648 - 40361606
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40361648 |
ccgtgagtttagctcagttggtagggatattgcatattatatg |
40361606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 41477431 - 41477385
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
41477431 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatg |
41477385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 42916386 - 42916432
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
42916386 |
atccccgtgagcttagctcagttggtagggatattgtatgttatatg |
42916432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 2362971 - 2363012
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2362971 |
cgtgagcttaactcagttggtagggatattgcatattatatg |
2363012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 177 - 222
Target Start/End: Original strand, 3198325 - 3198370
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
3198325 |
tccccgtgagcttagctcagttggtagggacattgcataatatatg |
3198370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 6414070 - 6414111
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6414070 |
cgtgagcttaactcagttggtagggatattgcatattatatg |
6414111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 22569317 - 22569272
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22569317 |
atccctgtgagcttagctcagttggtaggcatattgcatattatat |
22569272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 182 - 223
Target Start/End: Original strand, 29154846 - 29154887
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29154846 |
gtgagcttagctcagttggtagggatagtgcatattatatgt |
29154887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 178 - 222
Target Start/End: Complemental strand, 11188753 - 11188709
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
11188753 |
ccccgtgagcttagctcagttgataggaatattgcatattatatg |
11188709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 16891348 - 16891388
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16891348 |
cgtgagcttagctcagttggtagggatattgcattttatat |
16891388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 176 - 220
Target Start/End: Original strand, 16971619 - 16971663
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattata |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
16971619 |
atccccgtgagcttagctcagttggtagagatattgtatattata |
16971663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 25400434 - 25400394
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25400434 |
gtgagcatagctcagttggtagggatattgcatattatatg |
25400394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 175 - 223
Target Start/End: Complemental strand, 31074201 - 31074153
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||| |||||||| |
|
|
| T |
31074201 |
gatccccgtgagcttaactcagttggtagggatattacattttatatgt |
31074153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 988711 - 988758
Alignment:
| Q |
176 |
atccccgtgagcttagctcagtt-ggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
988711 |
atccccgtgagcttaactcagtttggtagggatattgcatattatatg |
988758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 180 - 223
Target Start/End: Original strand, 1469726 - 1469769
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1469726 |
ccgtgagtttagctcagttggtagagatattgcatattatatgt |
1469769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 8750971 - 8750928
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
8750971 |
cccgtgagcttagttaagttggtagggatattgcatattatatg |
8750928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 11146602 - 11146555
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
11146602 |
atccccgtgagcttagctcagttgataaggatattgcatgttatatgt |
11146555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 14641179 - 14641136
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
14641179 |
cccgtgagcttaactcaattggtagggatattgcatattatatg |
14641136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 19985500 - 19985543
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19985500 |
cccgtgaccttagctcagttggtagggatattgcataatatatg |
19985543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 20719735 - 20719782
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||| |||||||| |
|
|
| T |
20719735 |
atccccgtgagcttagatctgttggtagggatattgcattttatatgt |
20719782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 35113032 - 35112989
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
35113032 |
cccgtgagcttagttcagttgatagggatattgcatattatatg |
35112989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 171 - 222
Target Start/End: Original strand, 35241388 - 35241439
Alignment:
| Q |
171 |
tgtcgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| ||| |||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
35241388 |
tgtcaatctccgtgagcttagttcagttggtagagatattgcatattatatg |
35241439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 180 - 223
Target Start/End: Original strand, 42885830 - 42885873
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
42885830 |
ccgtgagcttagctaagttggtagagatattgcatattatatgt |
42885873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 3712139 - 3712093
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
3712139 |
atccccgtaagcttagctcagttggtagagatattgcattttatatg |
3712093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 6526047 - 6526093
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| |||||||||| |
|
|
| T |
6526047 |
atccccgtgagtttagctcagttggtagagatattggatattatatg |
6526093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 11786129 - 11786087
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
11786129 |
ccgtgagcttaactcagttggtagggatattgcattttatatg |
11786087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 17064931 - 17064885
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
17064931 |
atcctcgtgagcttaactcaattggtagggatattgcatattatatg |
17064885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 218
Target Start/End: Complemental strand, 18993534 - 18993492
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatatta |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
18993534 |
atccccgtgagcttagctcagttgatagggatattacatatta |
18993492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 21962178 - 21962132
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||| |||||||| |
|
|
| T |
21962178 |
atccccgtgagcttaactcagttggcagggatattgcaaattatatg |
21962132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 24132934 - 24132980
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||| ||||||||| |
|
|
| T |
24132934 |
atccccgtgagcttagctcagttgatagagatattgcgtattatatg |
24132980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 222
Target Start/End: Original strand, 28308243 - 28308277
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
28308243 |
ttagctcagttggtagggatattgcatattatatg |
28308277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 32423562 - 32423608
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||||| |
|
|
| T |
32423562 |
atccccgtgagcttaactcagttgttagggatattgtatattatatg |
32423608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 36124400 - 36124442
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
36124400 |
ccgtgagcttagctcagttgataggaatattgcatattatatg |
36124442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 39165018 - 39165060
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
39165018 |
ccgtgagtttagttcagttggtagggatattgcatattatatg |
39165060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 40081875 - 40081921
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||| ||||||| |
|
|
| T |
40081875 |
atccccgtgagcttagctcagttggtagagatattacatcttatatg |
40081921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 179 - 221
Target Start/End: Original strand, 42158882 - 42158924
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
42158882 |
cccgtgaacttagctcagtttgtagggatattgcatattatat |
42158924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 177 - 222
Target Start/End: Original strand, 4067980 - 4068025
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||| |||| |
|
|
| T |
4067980 |
tccccgtgagcttagctcagttggtagggacaatgcatattttatg |
4068025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 222
Target Start/End: Original strand, 10404133 - 10404170
Alignment:
| Q |
185 |
agcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10404133 |
agcttagctcagttggtaggaatattgcatattatatg |
10404170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 222
Target Start/End: Complemental strand, 17175127 - 17175078
Alignment:
| Q |
173 |
tcgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| |||| ||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
17175127 |
tcgatccccatgagtttaactcagttggtagggatattgcatgttatatg |
17175078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 182 - 215
Target Start/End: Original strand, 18928723 - 18928756
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
18928723 |
gtgagcttagctcagttggtagggatattgcata |
18928756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 222
Target Start/End: Original strand, 30571164 - 30571197
Alignment:
| Q |
189 |
tagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30571164 |
tagctcagttggtagggatattgcatattatatg |
30571197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 33433992 - 33433947
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
33433992 |
atccccgtgaacttagctcagttggtagaaatattgcatattatat |
33433947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 39028101 - 39028060
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
39028101 |
cgtgagattagctcatttggtagggatattgcatattatatg |
39028060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 40276510 - 40276469
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40276510 |
cgtgagtttagctcagttggtaggaatattgcatattatatg |
40276469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 180 - 221
Target Start/End: Complemental strand, 42842945 - 42842904
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
42842945 |
ccgtgagcttagctcagttggtagagatattgtatattatat |
42842904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 6119866 - 6119906
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
6119866 |
gtgagcttagctcagttggaagggatattgcattttatatg |
6119906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 179 - 215
Target Start/End: Complemental strand, 18049691 - 18049655
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18049691 |
cccgtgagcttagctcaattggtagggatattgcata |
18049655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 20370192 - 20370152
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
20370192 |
cgtgagcttagctcagttggtagggataatgcataatatat |
20370152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 29045890 - 29045930
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
29045890 |
gtgagtttagttcagttggtagggatattgcatattatatg |
29045930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 1670394 - 1670437
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
1670394 |
cccgtgagcttatatcagttggtagggatatggcatattatatg |
1670437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 24477825 - 24477868
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
24477825 |
cccgtgagcttagctcagttggtagggacgttgcataatatatg |
24477868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 215
Target Start/End: Original strand, 27498581 - 27498620
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
27498581 |
atcctcgtgagcttagctcggttggtagggatattgcata |
27498620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 188 - 223
Target Start/End: Complemental strand, 32389695 - 32389660
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32389695 |
ttagctcagttggtagagatattgcatattatatgt |
32389660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 32392194 - 32392155
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattata |
220 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
32392194 |
cgtgaacttagcttagttggtagggatattgcatattata |
32392155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 36716924 - 36716885
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
36716924 |
tgagcttaactcagctggtagggatattgcatattatatg |
36716885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 39147724 - 39147771
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||| ||| ||||||||||||| ||| |||||||||||||| |
|
|
| T |
39147724 |
atccccgtgagtttatctcagttggtaggaatactgcatattatatgt |
39147771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 41156332 - 41156371
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
41156332 |
tgagcttagctcggttgatagggatattgcatattatatg |
41156371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 216
Target Start/End: Original strand, 42317405 - 42317436
Alignment:
| Q |
185 |
agcttagctcagttggtagggatattgcatat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42317405 |
agcttagctcagttggtagggatattgcatat |
42317436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 191 - 222
Target Start/End: Complemental strand, 42718879 - 42718848
Alignment:
| Q |
191 |
gctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42718879 |
gctcagttggtagggatattgcatattatatg |
42718848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 4393857 - 4393899
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||| ||||||| |
|
|
| T |
4393857 |
ccgtgagcttagttcagttggtagggatgttgcattttatatg |
4393899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 9688745 - 9688699
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||| |||| |||| ||||||||||||||||| |
|
|
| T |
9688745 |
atccccgtgagcttagcttagtttgtagaaatattgcatattatatg |
9688699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 11017170 - 11017216
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||| |||||| |||||| |
|
|
| T |
11017170 |
atccgcgtgagtttagctcagttggtagggataatgcataatatatg |
11017216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 206
Target Start/End: Original strand, 13956899 - 13956929
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtaggga |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13956899 |
atccccgtgagcttagctcagttggtaggga |
13956929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 222
Target Start/End: Original strand, 18638603 - 18638641
Alignment:
| Q |
184 |
gagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
18638603 |
gagcttagctcagttggtagggatatcgcattttatatg |
18638641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 19891499 - 19891453
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||| ||||||||||| ||||||||||| ||||||| |
|
|
| T |
19891499 |
atcctcgtgagcttaactcagttggtaaggatattgcattttatatg |
19891453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 27241642 - 27241684
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
27241642 |
ccgtgagcttagctcagtttgtaggaatattacatattatatg |
27241684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 223
Target Start/End: Original strand, 32565523 - 32565565
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||| ||||||| |
|
|
| T |
32565523 |
cgtgagcttagctcagctggtagggataatgcataatatatgt |
32565565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 35512029 - 35511983
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||| ||||||| |
|
|
| T |
35512029 |
atccccgtgagcttaactcagttggtagggatatcacattttatatg |
35511983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 37034803 - 37034849
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||| |||| ||||||| |
|
|
| T |
37034803 |
atccccatgagcttagctcaattggtagggatatcgcattttatatg |
37034849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 39780803 - 39780849
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| ||||||| ||| |||||||||||||| ||||||| |
|
|
| T |
39780803 |
atccccgtgagcgtagctcaattgctagggatattgcattttatatg |
39780849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 223
Target Start/End: Complemental strand, 39804522 - 39804476
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||| |||||| ||| |||||||| ||||||| |
|
|
| T |
39804522 |
tccccgtgagcttagctcaattggtatggacattgcataatatatgt |
39804476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 223
Target Start/End: Original strand, 4153550 - 4153591
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
4153550 |
gtgaacttaactcagttggtagggatattgcattttatatgt |
4153591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 5485185 - 5485226
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
5485185 |
cgtgagcttagctcagttggtagggacaatgcataatatatg |
5485226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 179 - 216
Target Start/End: Complemental strand, 6291942 - 6291905
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatat |
216 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
6291942 |
cccgtgaacttagctcagttggtaggcatattgcatat |
6291905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 6489006 - 6489047
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
6489006 |
cgtgagcttagctcagttggtagggacaatgcataatatatg |
6489047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 7143416 - 7143457
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||| ||||||||||||||| |||||||||| |
|
|
| T |
7143416 |
cgtgagcttagttcaattggtagggatattgtatattatatg |
7143457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 209
Target Start/End: Original strand, 11795504 - 11795537
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatat |
209 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
11795504 |
atccctgtgagcttagctcagttggtagggatat |
11795537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 15889410 - 15889451
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
15889410 |
cgtgagcttagctcagttggtagggacaatgcataatatatg |
15889451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 206
Target Start/End: Complemental strand, 16701651 - 16701618
Alignment:
| Q |
173 |
tcgatccccgtgagcttagctcagttggtaggga |
206 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
16701651 |
tcgatcctcgtgagcttagctcagttggtaggga |
16701618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 17210771 - 17210730
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
17210771 |
cgtgagcttagctcagttggtagggacagtgcataatatatg |
17210730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 222
Target Start/End: Original strand, 26376961 - 26377006
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| |||||||||||||||| ||| | ||||||||||||| |
|
|
| T |
26376961 |
tccccgtgaacttagctcagttggtaaggacaatgcatattatatg |
26377006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 222
Target Start/End: Original strand, 27679493 - 27679538
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||| |||||| |
|
|
| T |
27679493 |
tccccgtgagcttagctcagttggtaaagataatgcataatatatg |
27679538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 209
Target Start/End: Complemental strand, 27852742 - 27852709
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatat |
209 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
27852742 |
atccccgtgagtttagctcagttggtagggatat |
27852709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 31591599 - 31591558
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||| | | ||||||||||||| |
|
|
| T |
31591599 |
cgtgagcttagctcagttggtaggaacaatgcatattatatg |
31591558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 34436850 - 34436891
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
34436850 |
cgtgagcttagctcagttggtagggacaatgcataatatatg |
34436891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 4238375 - 4238335
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
4238375 |
gtgagtttagttcagttggtatggatattgcatattatatg |
4238335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 223
Target Start/End: Complemental strand, 8752622 - 8752574
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||| |||||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
8752622 |
gatcctcgtgagtttagctcaattggtagggatattatatattatatgt |
8752574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 10758874 - 10758830
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||| |||||||| |||||| ||||||||||||||||||| |
|
|
| T |
10758874 |
cccgtgagtttagctcaattggtaaagatattgcatattatatgt |
10758830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 221
Target Start/End: Original strand, 13480251 - 13480295
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||| ||| |||||||||||||||| |||||||||||| ||||| |
|
|
| T |
13480251 |
tccccatgaacttagctcagttggtaaggatattgcataatatat |
13480295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 19273272 - 19273229
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
19273272 |
atccccgtgagc---gctcagttggtagggatattgcatgttatatg |
19273229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 22229029 - 22228989
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
22229029 |
gtgagtttagctcagttggtatggatattgcatgttatatg |
22228989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 223
Target Start/End: Complemental strand, 34860206 - 34860166
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
34860206 |
tgagcttagctcaattgatagggatattgtatattatatgt |
34860166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 215
Target Start/End: Complemental strand, 39800100 - 39800064
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||| |
|
|
| T |
39800100 |
cccgtgagcttagctcagttggtagggacaatgcata |
39800064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 222
Target Start/End: Complemental strand, 40098797 - 40098761
Alignment:
| Q |
186 |
gcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
40098797 |
gcttagctcagttgttaggaatattgcatattatatg |
40098761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 223
Target Start/End: Original strand, 43328273 - 43328313
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
43328273 |
tgagcttaactcagttggtagagatattgtatattatatgt |
43328313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0707 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 93 - 47
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
93 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
47 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 8963 - 9009
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8963 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
9009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 4087 - 4041
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4087 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
4041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 46523 - 46569
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46523 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
46569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 11991 - 12037
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11991 |
atcctcgtgaacttagctcagttggtagggatattgcatattatatg |
12037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 10899 - 10853
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10899 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
10853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 59780 - 59826
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
59780 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
59826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 47; Significance: 6e-18; HSPs: 3)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 266770 - 266724
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
266770 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
266724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 223
Target Start/End: Original strand, 173663 - 173703
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
173663 |
gtgagcttagctcagttcgtagg-atattgcatattatatgt |
173703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 223
Target Start/End: Original strand, 179176 - 179216
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
179176 |
gtgagcttagctcagttcgtagg-atattgcatattatatgt |
179216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 138)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 3446727 - 3446773
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3446727 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
3446773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 4183173 - 4183219
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4183173 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
4183219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 8250374 - 8250328
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8250374 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
8250328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 18694782 - 18694828
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18694782 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
18694828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 19281605 - 19281651
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19281605 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
19281651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 19684070 - 19684116
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19684070 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
19684116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 22653717 - 22653671
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22653717 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
22653671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 25857368 - 25857322
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25857368 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
25857322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 33229006 - 33228960
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33229006 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
33228960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 38400307 - 38400353
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38400307 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
38400353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 44948593 - 44948639
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44948593 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
44948639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 173 - 222
Target Start/End: Original strand, 41509510 - 41509559
Alignment:
| Q |
173 |
tcgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41509510 |
tcgatctccgtgagcttagctcagttggtagggatattgcatattatatg |
41509559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 178 - 222
Target Start/End: Original strand, 34613978 - 34614022
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34613978 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
34614022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 1260182 - 1260229
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1260182 |
atccccgtgagcttagctcagttggtagggatattgcatgttatatgt |
1260229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 15233409 - 15233456
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15233409 |
gatccccgtgagcttagctcaattggtagggatattgcatattatatg |
15233456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 28195208 - 28195161
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28195208 |
gatcctcgtgagcttagctcagttggtagggatattgcatattatatg |
28195161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 1844814 - 1844860
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1844814 |
atccccgtaagcttagctcagttggtagggatattgcatattatatg |
1844860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 2289607 - 2289653
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2289607 |
atccccgtgagcttagctcagttggtaggaatattgcatattatatg |
2289653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 2643694 - 2643740
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2643694 |
atccccgtgagcatagctcagttggtagggatattgcatattatatg |
2643740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 3438945 - 3438991
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3438945 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
3438991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 4562825 - 4562779
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4562825 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
4562779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 5521293 - 5521247
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5521293 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
5521247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 6331559 - 6331605
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6331559 |
atccccgtgagcatagctcagttggtagggatattgcatattatatg |
6331605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 11050830 - 11050784
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11050830 |
atccccgtgagcttagctcagttggtagggatattacatattatatg |
11050784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 15485659 - 15485705
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15485659 |
atccccgtgagcttagctcagttggtaaggatattgcatattatatg |
15485705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 15764927 - 15764973
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15764927 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatg |
15764973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 17034732 - 17034778
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17034732 |
atccccgtgagcttagctcaattggtagggatattgcatattatatg |
17034778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 17078454 - 17078500
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17078454 |
atccccgtgagcttagctcagttggtagggatattgtatattatatg |
17078500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 18278490 - 18278444
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18278490 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
18278444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 27297172 - 27297218
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27297172 |
atccccgtgagcttagctcagttggtagggatattgcatattgtatg |
27297218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 30932519 - 30932473
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30932519 |
atccccgtgagcttacctcagttggtagggatattgcatattatatg |
30932473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 33233295 - 33233249
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33233295 |
atccccgtgagcttatctcagttggtagggatattgcatattatatg |
33233249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 39408763 - 39408717
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39408763 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
39408717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 40535522 - 40535476
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40535522 |
atccccgtgagcttagctcagttggtacggatattgcatattatatg |
40535476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 44857307 - 44857261
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44857307 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatg |
44857261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 5062294 - 5062339
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5062294 |
atccccgtgagcttaactcagttggtagggatattgcatattatat |
5062339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 36182644 - 36182685
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36182644 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
36182685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 177 - 222
Target Start/End: Original strand, 41566760 - 41566805
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41566760 |
tccccgtgagcttagctcagttggtaggaatattgcatattatatg |
41566805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 2806571 - 2806527
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2806571 |
cccgtgagcttagctcagttggtagggatattgtatattatatgt |
2806527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 176 - 220
Target Start/End: Original strand, 5474903 - 5474947
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattata |
220 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5474903 |
atccccgtgagcttagctcagttggcagggatattgcatattata |
5474947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 6636034 - 6635994
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6636034 |
gtgagcttagctcagttggtagggatattgcatattatatg |
6635994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 19612715 - 19612759
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19612715 |
cccgtgagcttagttcagttggtagggatattgcatattatatgt |
19612759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 183 - 223
Target Start/End: Complemental strand, 30392898 - 30392858
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30392898 |
tgagcttagctcagttggtagggatattgcatattatatgt |
30392858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 27913539 - 27913496
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27913539 |
cccgtgagcttagctcaattggtagggatattgcatattatatg |
27913496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 33669733 - 33669780
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
33669733 |
atccccgtgagcttaactcagttagtagggatattgcatattatatgt |
33669780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 171 - 222
Target Start/End: Complemental strand, 38525631 - 38525580
Alignment:
| Q |
171 |
tgtcgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
38525631 |
tgtcaatccccgtgagcttagctcagttggtaaggatattgcattttatatg |
38525580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 180 - 223
Target Start/End: Complemental strand, 40363140 - 40363097
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40363140 |
ccgtgagcttaactcagttggtagggatattgcatattatatgt |
40363097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 466679 - 466633
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
466679 |
atccccgtgagcatagctcagttggtagggatattacatattatatg |
466633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 1071467 - 1071513
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
1071467 |
atccccgtgagcttagctcagttggtatggatattgtatattatatg |
1071513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 3287129 - 3287083
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3287129 |
atccctgtgagcttagctcagttggaagggatattgcatattatatg |
3287083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 7379673 - 7379627
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
7379673 |
atccccgtgagcttaactcagttggtaaggatattgcatattatatg |
7379627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 17487705 - 17487747
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17487705 |
ccgtgaacttagctcagttggtagggatattgcatattatatg |
17487747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 18803208 - 18803254
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
18803208 |
atccccgtgagcttagctcacttggtaggaatattgcatattatatg |
18803254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 20296415 - 20296461
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
20296415 |
atccccgtgagcttagctcagttgataaggatattgcatattatatg |
20296461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 27497601 - 27497555
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
27497601 |
atccccgtgagcatagctcagttggtagggatattgcatgttatatg |
27497555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 28194629 - 28194675
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28194629 |
atccccatgagcttagctcagttgctagggatattgcatattatatg |
28194675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 32609256 - 32609214
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32609256 |
ccgtgagcttaactcagttggtagggatattgcatattatatg |
32609214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 33041936 - 33041890
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33041936 |
atccccgtgagtttaactcagttggtagggatattgcatattatatg |
33041890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 44822420 - 44822466
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
44822420 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatg |
44822466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 177 - 222
Target Start/End: Original strand, 23405194 - 23405239
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
23405194 |
tccccgtgagcttagctcagttggtagggacattgcataatatatg |
23405239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 182 - 223
Target Start/End: Original strand, 32168931 - 32168972
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32168931 |
gtgagcttaactcagttggtagggatattgcatattatatgt |
32168972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 5612957 - 5612997
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5612957 |
gtgagcttagctcagttggcagggatattgcatattatatg |
5612997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 8742894 - 8742850
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
8742894 |
cccgtgagcttagctcagttggtagagatattacatattatatgt |
8742850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 178 - 222
Target Start/End: Original strand, 44658329 - 44658373
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
44658329 |
ccccgtgagcttagctcagttagtaggaatattgcatattatatg |
44658373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 27449183 - 27449226
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
27449183 |
cccgtgagcatagctcagttggtagggatattgcattttatatg |
27449226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 180 - 223
Target Start/End: Complemental strand, 29772347 - 29772304
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
29772347 |
ccgtgagcttaacacagttggtagggatattgcatattatatgt |
29772304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 30390439 - 30390396
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30390439 |
cccgtgaatttagctcagttggtagggatattgcatattatatg |
30390396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 31223624 - 31223663
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31223624 |
tgagcttagttcagttggtagggatattgcatattatatg |
31223663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 171 - 222
Target Start/End: Complemental strand, 33549132 - 33549081
Alignment:
| Q |
171 |
tgtcgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||| ||||||| |||||||||| |
|
|
| T |
33549132 |
tgtctatccccgtgagcttagctcagttgatagagatattgtatattatatg |
33549081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 41286127 - 41286174
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
41286127 |
gatctccgtgagcttggttcagttggtagggatattgcatattatatg |
41286174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 222
Target Start/End: Original strand, 1500970 - 1501004
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1500970 |
ttagctcagttggtagggatattgcatattatatg |
1501004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 179 - 221
Target Start/End: Original strand, 3301811 - 3301853
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
3301811 |
cccgtgagcttagctcatttggtagggatattgcattttatat |
3301853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 7281757 - 7281715
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
7281757 |
ccgtgagttaagctcagttggtagggatattgcatattatatg |
7281715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 7907616 - 7907570
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
7907616 |
atccccgtgagcttagtttaattggtagggatattgcatattatatg |
7907570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 177 - 215
Target Start/End: Original strand, 19958097 - 19958135
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19958097 |
tccccgtgagcttagctcagttggtagggacattgcata |
19958135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 177 - 215
Target Start/End: Original strand, 20919608 - 20919646
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20919608 |
tccccgtgagcttagctcagttggtagggacattgcata |
20919646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 22718134 - 22718088
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| || |||||||||| |
|
|
| T |
22718134 |
atccccgtgagcttaactcagttggtagggatactgtatattatatg |
22718088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 28153215 - 28153169
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
28153215 |
atcccagtgagcttaactcagttggtagggatattgcatgttatatg |
28153169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 35798099 - 35798053
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
35798099 |
atccccgtgagcttaactcagttgttagagatattgcatattatatg |
35798053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 36005439 - 36005485
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| || |||| |||||||||||||||||||||||||| |
|
|
| T |
36005439 |
atccccgtgagcgtaactcaattggtagggatattgcatattatatg |
36005485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 38179318 - 38179272
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38179318 |
atccctgtgagtttagctcagttggtagggatattgcattttatatg |
38179272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 38557296 - 38557250
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||| ||||||| |
|
|
| T |
38557296 |
atccccgtgagcttaactcagttggtagggatatggcattttatatg |
38557250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 177 - 215
Target Start/End: Original strand, 43214354 - 43214392
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43214354 |
tccccgtgagcttaactcagttggtagggatattgcata |
43214392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 43895910 - 43895956
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
43895910 |
atccccgtgagcttagctcagttggtagggatatcacattttatatg |
43895956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 43936702 - 43936744
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
43936702 |
ccgtgagcttagctcagttggtagggatatcgcattttatatg |
43936744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 8763379 - 8763424
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||| |||||| |
|
|
| T |
8763379 |
atccccgtgagcttagctcaattcgtagggatattgcattttatat |
8763424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 180 - 221
Target Start/End: Original strand, 27016278 - 27016319
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
27016278 |
ccgtgagcttagttcagttggtatggatattgcatattatat |
27016319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 182 - 223
Target Start/End: Complemental strand, 33222221 - 33222180
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33222221 |
gtgaacttaactcagttggtagggatattgcatattatatgt |
33222180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 222
Target Start/End: Complemental strand, 33563285 - 33563236
Alignment:
| Q |
173 |
tcgatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||| || ||||||| |
|
|
| T |
33563285 |
tcgatccccgtgaacttaactcagttggtagggatattgtattttatatg |
33563236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 40864401 - 40864442
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
40864401 |
cgtgagcttagctcagttggtaggaatattgcattttatatg |
40864442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 44021071 - 44021116
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| |||||| |
|
|
| T |
44021071 |
atccccgtgagcttaactcagttggtaggaatattgcatgttatat |
44021116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 23919544 - 23919504
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
23919544 |
gtgagcttagctcagttggtagggacattgcataatatatg |
23919504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 29942193 - 29942153
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
29942193 |
gtgagcttaactcagttagtagggatattgcatattatatg |
29942153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 37063523 - 37063563
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37063523 |
gtgatcttacctcagttggtagggatattgcatattatatg |
37063563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 37352560 - 37352520
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37352560 |
gtgagtttaactcagttggtagggatattgcatattatatg |
37352520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 4878206 - 4878253
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||| |||||||| |||| |||||||||| ||||||||||| |
|
|
| T |
4878206 |
atccccgtgagtttagctcacttggcagggatattgtatattatatgt |
4878253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 9330571 - 9330528
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
9330571 |
cccgtgagcttaactcagttgatagagatattgcatattatatg |
9330528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 219
Target Start/End: Complemental strand, 11144287 - 11144244
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
219 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
11144287 |
atccccgtgagtttagctcagttggtagaaatattgcatattat |
11144244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 219
Target Start/End: Original strand, 16040238 - 16040281
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
219 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
16040238 |
atcctcgtgagcttagttcagttggtagggatattgcatgttat |
16040281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 16385108 - 16385069
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
16385108 |
tgagcttagctcagttggtatggatattgcattttatatg |
16385069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 22589903 - 22589942
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
22589903 |
tgagcttatcttagttggtagggatattgcatattatatg |
22589942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 180 - 223
Target Start/End: Original strand, 40403556 - 40403599
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
40403556 |
ccgtgagcttaactcagttggtaggaatattgtatattatatgt |
40403599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 40473624 - 40473577
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| ||||||| |
|
|
| T |
40473624 |
gatccccgtgagcttaactcagttggtagaaatattgcatgttatatg |
40473577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 41939175 - 41939128
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
41939175 |
atcctcgtgagcttagcttagttggtagggataatgcataatatatgt |
41939128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 215
Target Start/End: Original strand, 43146349 - 43146388
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
43146349 |
atccccgtgagtttaactcagttggtagggatattgcata |
43146388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 5398180 - 5398134
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
5398180 |
atccctgtgaacttagctcagttggtagggatattacattttatatg |
5398134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 8322810 - 8322848
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
8322810 |
tgagcttagttcagttggtaggggtattgcatattatat |
8322848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 223
Target Start/End: Original strand, 11832946 - 11832992
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
11832946 |
tccccgtgagcttagttcagttggcaaggatatttcatattatatgt |
11832992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 17601080 - 17601122
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
17601080 |
ccgtgaacttaactcagttggtagggatattgcatatcatatg |
17601122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 222
Target Start/End: Original strand, 20435775 - 20435821
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggt-agggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||| |||| |
|
|
| T |
20435775 |
tccccgtgagcttagctcacttggtaagggatattgcatattttatg |
20435821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 24581537 - 24581491
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| |||||| ||||||||| |||||||||||||| |||||| |
|
|
| T |
24581537 |
atccccgtaagcttaactcagttggcagggatattgcataatatatg |
24581491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 218
Target Start/End: Original strand, 25932537 - 25932575
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatatta |
218 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
25932537 |
ccgtgaacttagctcagttggtagggatattgtatatta |
25932575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 29449445 - 29449491
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
29449445 |
atccccatgagcttagctcagttggtagggatatcacattttatatg |
29449491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 33262439 - 33262485
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||| |||| ||||||| |
|
|
| T |
33262439 |
atccccgtgagtttagctcagctggtagggatatcgcattttatatg |
33262485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 33816489 - 33816443
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| || ||| |||||||||||| |||||||||||||||||| |
|
|
| T |
33816489 |
atccccgtcagtttacctcagttggtagagatattgcatattatatg |
33816443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 215
Target Start/End: Complemental strand, 35429674 - 35429636
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
35429674 |
tccccgtgagcttagctcagttggtagagacattgcata |
35429636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 40688712 - 40688666
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| ||||| ||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
40688712 |
atcctcgtgatcttagctcagttggtagagatattgcattttatatg |
40688666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 42199947 - 42199909
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
42199947 |
tgagtttaactcagttggtagggatattgcatattatat |
42199909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 44898555 - 44898509
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||| ||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
44898555 |
atcctcgtgaggttaactcagttggtaggaatattgcatattatatg |
44898509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 5507021 - 5506976
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||||| ||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
5507021 |
atccccgtaagcttagttcagttggtaggaacattgcatattatat |
5506976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 206
Target Start/End: Complemental strand, 10463270 - 10463241
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtaggga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10463270 |
tccccgtgagcttagctcagttggtaggga |
10463241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 221
Target Start/End: Original strand, 12747739 - 12747780
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
12747739 |
ccgtgagcttaactcagttggtagaaatattgcatattatat |
12747780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 210
Target Start/End: Complemental strand, 13606311 - 13606282
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatatt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13606311 |
cgtgagcttagctcagttggtagggatatt |
13606282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 222
Target Start/End: Complemental strand, 18231539 - 18231494
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| ||| | |||||| |||||| |
|
|
| T |
18231539 |
tccccgtgagcttagctcagttggtaaggacaatgcataatatatg |
18231494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 222
Target Start/End: Complemental strand, 19179116 - 19179071
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| ||| | |||||| |||||| |
|
|
| T |
19179116 |
tccccgtgagcttagctcagttggtaaggacaatgcataatatatg |
19179071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 20565137 - 20565096
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
20565137 |
cgtgagcttagctcagttggtagggacaatgcataatatatg |
20565096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 222
Target Start/End: Original strand, 34355727 - 34355764
Alignment:
| Q |
185 |
agcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
34355727 |
agctcagctcagttggtagggatattgtatattatatg |
34355764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 35367408 - 35367453
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
221 |
Q |
| |
|
|||||| ||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
35367408 |
atccccatgagcttagctcagttgataatgatattgcatattatat |
35367453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 220
Target Start/End: Complemental strand, 36143259 - 36143222
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattata |
220 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
36143259 |
tgagtttagctcagttggtcgggatattgcatattata |
36143222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 36748889 - 36748926
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatatta |
218 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
36748889 |
cgtgagcttaactcagttggtagggacattgcatatta |
36748926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 193 - 222
Target Start/End: Original strand, 38387677 - 38387706
Alignment:
| Q |
193 |
tcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38387677 |
tcagttggtagggatattgcatattatatg |
38387706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 3349686 - 3349726
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3349686 |
gtgagcttagctcagttggtataaatattgcatattatatg |
3349726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 5003703 - 5003663
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
5003703 |
gtgagcttgactcagttggtagggatattgcattttatatg |
5003663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 215
Target Start/End: Complemental strand, 15654933 - 15654897
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
15654933 |
cccgtgagcttagctcagttggtaaggataatgcata |
15654897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 27152353 - 27152393
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||| |||||| |
|
|
| T |
27152353 |
gtgagcttaactcagttggtagggataatgcataatatatg |
27152393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 223
Target Start/End: Original strand, 31156818 - 31156854
Alignment:
| Q |
187 |
cttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
31156818 |
cttagctcagttggtagggataatgcataatatatgt |
31156854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 223
Target Start/End: Complemental strand, 34191368 - 34191328
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||| | |||||| ||||||| |
|
|
| T |
34191368 |
tgagcttagctcagttggtagggacaatgcataatatatgt |
34191328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 220
Target Start/End: Original strand, 43842123 - 43842163
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattata |
220 |
Q |
| |
|
|||||| |||| |||||||||||||||||||| |||||||| |
|
|
| T |
43842123 |
ccgtgaacttaactcagttggtagggatattgtatattata |
43842163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0100 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 175 - 219
Target Start/End: Original strand, 45880 - 45924
Alignment:
| Q |
175 |
gatccccgtgagcttagctcagttggtagggatattgcatattat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45880 |
gatccccgtgagcttagctcagttggtagggatattgcatattat |
45924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 930 - 887
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
930 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 12331 - 12288
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12331 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
12288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1185 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold1185
Description:
Target: scaffold1185; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 2446 - 2400
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2446 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
2400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: scaffold0460
Description:
Target: scaffold0460; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 12456 - 12502
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12456 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
12502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 222
Target Start/End: Complemental strand, 13266 - 13230
Alignment:
| Q |
186 |
gcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13266 |
gcttagctcagttggtagggatattgcatattatatg |
13230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 8818 - 8864
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8818 |
atccccgtgagcttagctcagttggtagggatattgcattttatatg |
8864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 112105 - 112151
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
112105 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
112151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 8898 - 8852
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8898 |
atccccgtgagcttagctcagttggtagggatattgcatattttatg |
8852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 182 - 223
Target Start/End: Complemental strand, 65854 - 65813
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
65854 |
gtgagcttagctcagttggtagggatattgcatattatatgt |
65813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0288 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 178 - 222
Target Start/End: Original strand, 21263 - 21307
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21263 |
ccccgtgagcttagcttagttggtagggatattgcatattatatg |
21307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0690 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0690
Description:
Target: scaffold0690; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 3666 - 3709
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3666 |
cccgtgagcttaactcagttggtagggatattgcatattatatg |
3709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 178 - 224
Target Start/End: Original strand, 5981 - 6027
Alignment:
| Q |
178 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgtg |
224 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
5981 |
ccccgtgagcttagctcatttgatagggatattgcatattatatgtg |
6027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0157 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 15761 - 15807
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15761 |
atcctcgtgagcttatctcagttggtagggatattgcatattatatg |
15807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 37487 - 37441
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37487 |
atcctcgtgagcttaactcagttggtagggatattgcatattatatg |
37441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 23361 - 23404
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23361 |
cccgtgaacttaactcagttggtagggatattgcatattatatg |
23404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1372 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold1372
Description:
Target: scaffold1372; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 222
Target Start/End: Original strand, 1871 - 1907
Alignment:
| Q |
186 |
gcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1871 |
gcttagctcagttggtagggatattgcatattatatg |
1907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 3660 - 3620
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3660 |
gtgagcttagctcagttggtagggatatttcatattatatg |
3620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 50071 - 50027
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
50071 |
cccgtgagcttaactcagttgatagggatattgcatattatatgt |
50027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0330 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0330
Description:
Target: scaffold0330; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 180 - 223
Target Start/End: Original strand, 6769 - 6812
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6769 |
ccgtgaacttaactcagttggtagggatattgcatattatatgt |
6812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 219
Target Start/End: Complemental strand, 236428 - 236385
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
219 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
236428 |
atccccgtgagattagttcagttggtagggatattgcatattat |
236385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 397 - 443
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| ||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
397 |
atccccgtgaacttagctcaattgatagggatattgcatattatatg |
443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 222
Target Start/End: Complemental strand, 11181 - 11147
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11181 |
ttagctcagttggtagggatattgcatattatatg |
11147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 222
Target Start/End: Complemental strand, 21509 - 21475
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
21509 |
ttagctcagttggtagggatattgcatattatatg |
21475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 28003 - 27957
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
28003 |
atcctcgtgagcttagctcggttggtagggatattgcattttatatg |
27957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 222
Target Start/End: Original strand, 315646 - 315692
Alignment:
| Q |
176 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
315646 |
atccccgtgaacttagctcagttggtaaggatattgcattttatatg |
315692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1709 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold1709
Description:
Target: scaffold1709; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 175 - 214
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
175 |
tgagcttagctcagttggtatagatattgcatattatatg |
214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1331 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold1331
Description:
Target: scaffold1331; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 146 - 107
Alignment:
| Q |
183 |
tgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
146 |
tgagcttagctcagttggtatagatattgcatattatatg |
107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0394 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0394
Description:
Target: scaffold0394; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 1262 - 1305
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||| |||||||||| |
|
|
| T |
1262 |
cccgtgagcttaactcagttggtaggaatattgtatattatatg |
1305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0254 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0254
Description:
Target: scaffold0254; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 1317 - 1360
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||| |||||||||| |
|
|
| T |
1317 |
cccgtgagcttaactcagttggtaggaatattgtatattatatg |
1360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 180 - 215
Target Start/End: Original strand, 15006 - 15041
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcata |
215 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15006 |
ccgtgagcttagctcagttggtagggacattgcata |
15041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0063
Description:
Target: scaffold0063; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 56323 - 56366
Alignment:
| Q |
179 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||||||||||||||| |
|
|
| T |
56323 |
cccgtgagcttaactcaattggcagggatattgcatattatatg |
56366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 222
Target Start/End: Complemental strand, 59243 - 59205
Alignment:
| Q |
184 |
gagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
59243 |
gagcttagttcagttggtagagatattgcatattatatg |
59205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 222
Target Start/End: Original strand, 510965 - 510999
Alignment:
| Q |
188 |
ttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
510965 |
ttagctcagttagtagggatattgcatattatatg |
510999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0555 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0555
Description:
Target: scaffold0555; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 206
Target Start/End: Original strand, 9309 - 9338
Alignment:
| Q |
177 |
tccccgtgagcttagctcagttggtaggga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9309 |
tccccgtgagcttagctcagttggtaggga |
9338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0517
Description:
Target: scaffold0517; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 4883 - 4924
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||||| |
|
|
| T |
4883 |
cgtgagcttggctcagttagtagggatattgcataatatatg |
4924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0276 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0276
Description:
Target: scaffold0276; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 223
Target Start/End: Original strand, 1263 - 1304
Alignment:
| Q |
182 |
gtgagcttagctcagttggtagggatattgcatattatatgt |
223 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||| |||||||| |
|
|
| T |
1263 |
gtgagcttagctcagctggtaggaatattgcattttatatgt |
1304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0199 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0199
Description:
Target: scaffold0199; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 8984 - 8943
Alignment:
| Q |
181 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
222 |
Q |
| |
|
||||||| || |||| |||||||||||||||||||||||||| |
|
|
| T |
8984 |
cgtgagcataactcaattggtagggatattgcatattatatg |
8943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 217
Target Start/End: Original strand, 44379 - 44416
Alignment:
| Q |
180 |
ccgtgagcttagctcagttggtagggatattgcatatt |
217 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
44379 |
ccgtaagcttaactcagttggtagggatattgcatatt |
44416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University