View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_482 (Length: 228)
Name: NF10855A_low_482
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_482 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 170 - 228
Target Start/End: Complemental strand, 14722050 - 14721992
Alignment:
| Q |
170 |
aagttatgtaaagtgatgttcatagatggtcaaatttagtggggttagcaaaaatgttg |
228 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14722050 |
aagttctgtaaagtgatgttcatagatggtcaaatttagtggggttagcaaaaatgttg |
14721992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 170 - 228
Target Start/End: Original strand, 39465201 - 39465259
Alignment:
| Q |
170 |
aagttatgtaaagtgatgttcatagatggtcaaatttagtggggttagcaaaaatgttg |
228 |
Q |
| |
|
||||| |||||||| ||||||||| ||||||| ||||||||| |||||||||||||||| |
|
|
| T |
39465201 |
aagttctgtaaagtaatgttcatatatggtcagatttagtggagttagcaaaaatgttg |
39465259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University