View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_494 (Length: 226)
Name: NF10855A_low_494
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_494 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 7 - 223
Target Start/End: Complemental strand, 2727939 - 2727721
Alignment:
| Q |
7 |
tttggtgtttatcctatggatacaaattggggagttgcattgcttgatcttttgggaaatttggcatttcctttgatattgcttggtactttactcctta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2727939 |
tttggtgtttatcctatggatacaaattggggagttgcaatacttgatcttttgggaaatttggcatttcctttgatattgcttggtactttactcctta |
2727840 |
T |
 |
| Q |
107 |
ggacatctagaaataattctgttggtggccctaacttgccatttggattaggaaggtatgaattgtagcacgtgaaacttcc--ataactataaggatct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
2727839 |
ggacatctagaaataattctgttggtggccctaacttgccatttggattaggaaggtatgaattgtagcacgtgaaacttccatataactataaggattt |
2727740 |
T |
 |
| Q |
205 |
aattccgtatatgcaccga |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2727739 |
aattccgtatatgcaccga |
2727721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University