View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_495 (Length: 225)
Name: NF10855A_low_495
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_495 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
| [»] scaffold1377 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 48 - 225
Target Start/End: Original strand, 25614660 - 25614837
Alignment:
| Q |
48 |
gataagtatagtggtgtttagtatgaatgagttctagggtggactgcaattgtggattgataaaaattctgtttggatgcttttacttttagnnnnnnnn |
147 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25614660 |
gataagtataatggtgtttagtatgaatgagttctagggtggactgcaattgtggattgataaaaattctgtttggatgcttttacttttagttttctct |
25614759 |
T |
|
| Q |
148 |
attgtctggaaagttggtattttataccaccagaaattatataaattttatttgtgagttatcttggtttaattttga |
225 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25614760 |
attgtctggaaagttggtattttatactactagaaattatataaattttatttgtgagttgtcttggtttaattttga |
25614837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 60 - 138
Target Start/End: Original strand, 31262760 - 31262838
Alignment:
| Q |
60 |
ggtgtttagtatgaatgagttctagggtggactgcaattgtggattgataaaaattctgtttggatgcttttactttta |
138 |
Q |
| |
|
|||||||||||||||||| || |||||| ||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
31262760 |
ggtgtttagtatgaatgaattttagggtagactgcaattgtggattgataaaaattctgtttcgatgcttttaccttta |
31262838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1377 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold1377
Description:
Target: scaffold1377; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 79 - 137
Target Start/End: Complemental strand, 1148 - 1090
Alignment:
| Q |
79 |
ttctagggtggactgcaattgtggattgataaaaattctgtttggatgcttttactttt |
137 |
Q |
| |
|
||||||| |||||| ||||||||||||||||| ||||| ||||||||||||||| |||| |
|
|
| T |
1148 |
ttctaggatggactacaattgtggattgataacaattcggtttggatgcttttattttt |
1090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University