View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_497 (Length: 225)
Name: NF10855A_low_497
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_497 |
 | |
|
| [»] scaffold0191 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 200
Target Start/End: Complemental strand, 929929 - 929746
Alignment:
| Q |
17 |
cagaaccggggctctcaatttttgcaacattgtggtatcaaaggtgggaagaaaggtaggaaattctcacatttatcgtgtatggatggatacaatctaa |
116 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
929929 |
cagaacccgtgctctcaatttttgcaacattgtggtatcaaaggtggtaagaaaggtaggaaattctcacatttatcgtgtatggatggatacaatctaa |
929830 |
T |
|
| Q |
117 |
tgcattttgctaggtagaaatcaaattatctttgaaggaaactcaatgaatgtaagcggcatagtgtcgcatattaaaatggtt |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
929829 |
tgcatttttctaggtagaaatcaaattatctttgaaggaaactcaatgaatgtaagcggcatagtgtcgcatattaaaatggtt |
929746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0191 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0191
Description:
Target: scaffold0191; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 91
Target Start/End: Original strand, 24919 - 24981
Alignment:
| Q |
29 |
tctcaatttttgcaacattgtggtatcaaaggtgggaagaaaggtaggaaattctcacattta |
91 |
Q |
| |
|
||||| || |||||||| ||||||||||||||||| ||||||| |||||||| |||||||||| |
|
|
| T |
24919 |
tctcatttattgcaacactgtggtatcaaaggtggtaagaaagataggaaatgctcacattta |
24981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University