View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_505 (Length: 223)
Name: NF10855A_low_505
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_505 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 15 - 205
Target Start/End: Complemental strand, 19194857 - 19194667
Alignment:
| Q |
15 |
gacatcatttcagcacatgattgcggacgagaataacgctcaatagcttcagaagttagaccattgagattcccgcagagagaacaaccccacgaccatt |
114 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19194857 |
gacatcatttcagcacaagattgcggacgagaataacgctcaatagcttcagaagttagaccattgagattcccgcagagagaacacccccacgaccatt |
19194758 |
T |
|
| Q |
115 |
gttcgcgatcacagtaggtgttgaagtacgcccagcaattctcgcaccggggtaaaagctcgccgctggatccgtataccggtgattggtt |
205 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19194757 |
gttcgagatcacagtaggtgttgaagtacgcccagcaattctcgcaccggggtaaaagctcgccgctggatccgtataccggtgattggtt |
19194667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 126 - 190
Target Start/End: Complemental strand, 11107822 - 11107758
Alignment:
| Q |
126 |
cagtaggtgttgaagtacgcccagcaattctcgcaccggggtaaaagctcgccgctggatccgta |
190 |
Q |
| |
|
||||| |||||||||||||||| ||||||||| || ||||||||||||||||||||| ||||||| |
|
|
| T |
11107822 |
cagtacgtgttgaagtacgccctgcaattctctcatcggggtaaaagctcgccgctgtatccgta |
11107758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University