View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_510 (Length: 222)
Name: NF10855A_low_510
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_510 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 22 - 215
Target Start/End: Complemental strand, 31962779 - 31962586
Alignment:
| Q |
22 |
aatgccatgatctcaaacaattattacagagctttccatttctctgactgattctcatctttcactttgagttgaattcatcttgaataaactaatgaaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
31962779 |
aatgccatgatctcaaacaattattacagagctttccatttctctgactgattctcatctttcactttgagttgaactcatcttgagtaaactaatgaaa |
31962680 |
T |
|
| Q |
122 |
gtaccaaaactggacagcacaataccacagttttccggtgtatggcatcattaataccctttgtttacacgaatcctagctctgatgtccatct |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |||| |
|
|
| T |
31962679 |
gtaccaaaactggacagcacaataccgcagttttccggtgtatggcatcattaataccctttgtttccacgaatcctagctctcatgtcaatct |
31962586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University