View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_526 (Length: 218)
Name: NF10855A_low_526
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_526 |
 |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0027 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 6 - 210
Target Start/End: Original strand, 45715 - 45915
Alignment:
| Q |
6 |
ctgagatgaacctgattctttgggatcattctggtatagaaaacagtgtttgaacagtaaaaaatctgcatgtgggtgcagtcactatgtaattagcctg |
105 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45715 |
ctgacatgaacctgattctttgggatcattctggtatagaaaacagtgtttgaacagtaaaaaatttgcatgtgggtgcagtcactatgtaattagcctg |
45814 |
T |
 |
| Q |
106 |
aaattgagcataggattcctatcacatagaggtactcctacgtactccctcatttttgtagggatgatgctactcggcattccaaatctttgtttccttt |
205 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45815 |
aaattgaacataggattcctatcacatagaggtactcc----tactccctaatttttgtagggaagatgctactcggcattccaaatctttgtttctttt |
45910 |
T |
 |
| Q |
206 |
aataa |
210 |
Q |
| |
|
||||| |
|
|
| T |
45911 |
aataa |
45915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University