View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_531 (Length: 217)
Name: NF10855A_low_531
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_531 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 46421143 - 46421340
Alignment:
| Q |
1 |
caatgagatggacatcaaatagcggtctgcaaagatgaagttctgccaagagacagccgacagaaaatatgtcccttgcaatatcttcagaggcaagtct |
100 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46421143 |
caatgagattga-atcaaatagcggtctgcaaagatgaagttctgccaagagacagccgacagaaaatatgtcccttgcaatatcttcagaggcaagtct |
46421241 |
T |
 |
| Q |
101 |
tgaagaagacaatttctgcctccagagaagcaagtccggatatcctgaaaagccttcatcttcctctttcatatgttgaagaaaagatatatggttcat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46421242 |
tgaagaagacaatttctgcctccagagaagcaagtctggatatcctgaaaagccttcatcttcctctttcatatgttgaagaaaagatatatggttcat |
46421340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University