View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_534 (Length: 216)
Name: NF10855A_low_534
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_534 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 13 - 188
Target Start/End: Original strand, 9897822 - 9897997
Alignment:
| Q |
13 |
tggacatcattatgaagcatgaccgaacaaggtttagcttcccctgcaccttggtttggatctaagacaatgtagatatttaccagcacgactaaattac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
9897822 |
tggacatcattatgaagcatgaccgaacaaggtttagcttcccctgccccttggtttggatctaagacaatgtagatatttaccagcacgactccattgc |
9897921 |
T |
|
| Q |
113 |
actggggtggctagccctgatgacaagtcaattgtttgtattacatccctattatagcctagccatttttgaatat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9897922 |
actggggtggctagccctgatgacaagtcaattgtttgtattacatccctattatagcctagccatttttgaatat |
9897997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University