View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_535 (Length: 215)
Name: NF10855A_low_535
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_535 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 18 - 183
Target Start/End: Original strand, 52478151 - 52478315
Alignment:
| Q |
18 |
aaattaacattagatagtcatggtcatgagtgacgccatgccattgttgacggcctattagcaactggtctagaactgttgttattctcagtggacattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52478151 |
aaattaacattagatagtcatggtcatgagtgacgccatgccattgttgacggcctattagcaactggtctagaactgttgttattctcagtggacattt |
52478250 |
T |
|
| Q |
118 |
acaccatcactttaccgttttttatttgtataagttaattataacggtgatcttttttaatattgt |
183 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52478251 |
acaccatcactttacc-tttattatttgtataagtaaattataacggtgatcttttttaatattgt |
52478315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University