View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_537 (Length: 215)
Name: NF10855A_low_537
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_537 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 23 - 195
Target Start/End: Original strand, 11696800 - 11696972
Alignment:
| Q |
23 |
gtggatgtcttgagaaaggtttacgcgtattcgagaatatgtcggagaagaatagattttcttacactgtaatgatatctggtcttgcgattcatggacg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11696800 |
gtggatgtcttgagaaaggtttacgcgtattcaaaaatatgtcggagaagaatagatattcttacactgtaatgatatctggtcttgcgattcatggacg |
11696899 |
T |
|
| Q |
123 |
tggtaaggaagctcttaaagttttctcagaaatgattgaagaaggtttggcaccagatgatgttgtctatgtt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11696900 |
tggtaaggaagctcttaaagttttctcagaaatgattgaagaaggtttggcaccagatgatgttgtctatgtt |
11696972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University