View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_539 (Length: 214)
Name: NF10855A_low_539
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_539 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 20 - 196
Target Start/End: Original strand, 28586921 - 28587097
Alignment:
| Q |
20 |
gtaatatatatggatacagaatatatggggagattggtaaaatatatgagtagattaaagctaatggtgtcatacactcatactatcatttcactaaatc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28586921 |
gtaatatatatggatacagaatatatggggagattggtaaaatatatcagtagattaaagttaatggtgtcatacactcatactatcatttcactaaatc |
28587020 |
T |
 |
| Q |
120 |
caatcatattttataaaatagaaaagttaacaagaaaaggtaaacgtttaccatatgttcccaagtatagatctttg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28587021 |
caatcatattttataaaatagaaaagttaacaagaataggtaaacgtttaccatatgttcccaagtatagatctttg |
28587097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University