View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_541 (Length: 214)
Name: NF10855A_low_541
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_541 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 58 - 192
Target Start/End: Complemental strand, 27624287 - 27624153
Alignment:
| Q |
58 |
ttagtatgttactcctacttaattgatgtataacaaaattgaaattaaagcaacaaaataannnnnnnnnatgagcaactaaatacatgatatcgaagtg |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||||| | ||| |
|
|
| T |
27624287 |
ttagtatgttactcctacttaattgatgtataacaaaagtgaaaataaagcaacaaaataa-ttttttttatgagcaactaaatacatgatatcaaggtg |
27624189 |
T |
|
| Q |
158 |
actatatcagaatcatgac-aatccaccgtgatttt |
192 |
Q |
| |
|
| ||| ||| | |||| || | |||||||||||||| |
|
|
| T |
27624188 |
agtatgtcaaactcataacgattccaccgtgatttt |
27624153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University