View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10855A_low_559 (Length: 209)

Name: NF10855A_low_559
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10855A_low_559
NF10855A_low_559
[»] chr8 (1 HSPs)
chr8 (19-189)||(31798689-31798862)


Alignment Details
Target: chr8 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 19 - 189
Target Start/End: Complemental strand, 31798862 - 31798689
Alignment:
19 aattgattttaattgctagttcgattgctcagtagaacaattcttgcaagattttgttt--atataattcaagtagnnnnnnnnnnn-aataggaattca 115  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||  |||||||||||||||            ||||||||||||    
31798862 aattgattttaattactagttcgattgctcagtagaacaattcttgcaagattttttttttatataattcaagtagttttttttttttaataggaattca 31798763  T
116 agtaggcaatttgaagattcaagttcaatcacgaaataatggatggtccatgaaaatcttatgacaaagccact 189  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31798762 agtaggcaatttgtagattcaagttcaatcacgaaataatggatggtccatgaaaatcttatgacaaagccact 31798689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University