View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_560 (Length: 209)
Name: NF10855A_low_560
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_560 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 111 - 182
Target Start/End: Complemental strand, 37616860 - 37616789
Alignment:
| Q |
111 |
ctctctctaacacttctttgtttgacatttttatggatttgcatttgcaagaatttaaacccctcatttggg |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37616860 |
ctctctctaacacttctttgtttgacatttttatggatttgcatttgcaagaatttaaacccctcatttggg |
37616789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 111 - 182
Target Start/End: Original strand, 19768427 - 19768498
Alignment:
| Q |
111 |
ctctctctaacacttctttgtttgacatttttatggatttgcatttgcaagaatttaaacccctcatttggg |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19768427 |
ctctctctaacacttctttgtttgacatttttatggatttgcatttgcaagaatttaaacccctcatttggg |
19768498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 114 - 182
Target Start/End: Original strand, 29199942 - 29200010
Alignment:
| Q |
114 |
tctctaacacttctttgtttgacatttttatggatttgcatttgcaagaatttaaacccctcatttggg |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29199942 |
tctctaacacttctttgtttgacatttttatggatttgcatttgcaagaatttaaacccctcatttggg |
29200010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 111 - 174
Target Start/End: Complemental strand, 51389526 - 51389463
Alignment:
| Q |
111 |
ctctctctaacacttctttgtttgacatttttatggatttgcatttgcaagaatttaaacccct |
174 |
Q |
| |
|
|||| ||||| |||||||||||||| ||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
51389526 |
ctctttctaaaacttctttgtttgatctttttatggatttgcatttgcgagaatttaagcccct |
51389463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 116 - 174
Target Start/End: Original strand, 770534 - 770592
Alignment:
| Q |
116 |
tctaacacttctttgtttgacatttttatggatttgcatttgcaagaatttaaacccct |
174 |
Q |
| |
|
||||| ||||||||||||| | ||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
770534 |
tctaaaacttctttgtttggcctttttatggatttgcatttgcgagaatttaagcccct |
770592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University