View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_563 (Length: 208)
Name: NF10855A_low_563
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_563 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 19 - 189
Target Start/End: Complemental strand, 47436878 - 47436708
Alignment:
| Q |
19 |
gaaacaactgagttgtgagctaggtcttacaccgacgcaaatcaagttctggtctcaaaacaagcgcaaccaaattaaggtaaaggattatgaaaaccct |
118 |
Q |
| |
|
||||||| |||||||||||||||| |||||||| ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47436878 |
gaaacaattgagttgtgagctaggccttacacctgcgcaaatcaagttctagtttcaaaacaagcgcaaccaaattaaggtaaaggattatgaaaaccct |
47436779 |
T |
|
| Q |
119 |
attgaaatgtgagatcttacatgcatggtgaacccttaaaaataaatgtgtatttcctctggtctctgtta |
189 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47436778 |
attgaaatttgagatcttacatgcacggtgaacccttaaaaataaatgtgtatttcctctggtctcggtta |
47436708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University